Zinc sensor (ZitR + CRISPRi)
Detects zinc, a nutritional and water-quality marker. The native L. lactis ZitR zinc regulator gates a CRISPRi circuit driving a fluorescent reporter, in the food-grade GRAS chassis Lactococcus lactis.
Chemical / metaboliteBSL-1 chassisGRAStemplatezincmicronutrientwater-qualitychemicalfoodGRASCRISPRi
Input
Zinc Zn(II)
Chemical / metabolite
→
Sense
CRISPRi-repression
dCas9 (S. pyogenes, catalytically dead)
→
Chassis
Lactococcus lactis (MG1363)
BSL-1
→
Output
mCherry
fluorescent
What it detects
- Analyte
- Zinc Zn(II) — ZitR-based sensing responds across µM zinc
- Category
- Chemical / metabolite
- Signal
- Bioavailable zinc in water, food, or nutritional samples
Genetic circuit
⤢ click to enlarge
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
⤢ click to enlarge
CRISPR sensing mechanism
- Strategy
- CRISPRi-repression · NOT logic
- Cas protein
- dCas9 (S. pyogenes, catalytically dead)
- Analyte sensor
- ZitR (a zinc-responsive repressor of the zitSQP operon) binds Zn(II) and changes occupancy of its operator/promoter.
Signal flow
Zn(II) -> ZitR releases PzitS -> transcribes an anti-reporter sgRNA -> dCas9 + sgRNA repress a constitutive reporter (CRISPRi NOT gate). Pair an inverter for turn-on.Safe chassis
Lactococcus lactis (MG1363) — Lactococcus lactis
Food-grade, GRAS lactic acid bacterium used for centuries in dairy fermentation. Non-colonizing and ideal for ingestible / clinical biosensors where a food-safe, gut-transient host is wanted.
BSL-1GRAS · FDA GRAS for food useprobiotic
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| ZitR regulator Native zinc-responsive repressor — no porting needed in L. lactis. | regulator | Lactococcus lactis zit operon |
| PzitS promoter Zinc-modulated via ZitR. | promoter | L. lactis zitSQP operon promoter |
| Anti-reporter sgRNA | sgRNA | designed against the reporter promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| dCas9 | dCas9 | CRISPRi (demonstrated in lactic acid bacteria) |
| mCherry reporter Food-compatible fluorescent readout. | reporter | standard fluorophore |
Output & readout
- Type
- fluorescent
- Reporter
- mCherry
- Readout
- Fluorescence (plate reader)
- Positive result
- Fluorescence change reports zinc concentration.
Performance
- Limit of detection
- ZitR module: µM zinc (module-validated in L. lactis).
- Dynamic range
- ~1-100 µM zinc
- Response time
- ~180 min
- Device validated
- No — design template (parts validated individually)
ZitR is the native L. lactis zinc regulator (no porting); CRISPRi in lactic acid bacteria is established. Integrated device is a design template.
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- Yes
- Biocontainment
- thyA-based biological containment demonstrated in L. lactis; food-grade host.
- Field-deployable
- Lab / supervised use
GRAS / food-grade chassis (no LPS endotoxin); suited to food and nutritional zinc monitoring.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Design anti-reporter sgRNA Target the reporter promoter; check L. lactis off-targets. |
| 2 | assembly | Assemble units TU1: PzitS -> sgRNA (native ZitR). TU2: dCas9 + constitutive mCherry. Use NICE-compatible vectors. |
| 3 | transformation | Transform L. lactis MG1363 Electroporate; select (ErmR/CmR); add thyA containment. |
| 4 | induction | Expose to zinc Validate across a zinc standard curve. |
| 5 | readout | Measure fluorescence Interpolate zinc from the curve. |
Source & parts
- Design
- Design template combining the native L. lactis ZitR zinc-sensing module with CRISPRi
- Parts validated in
- Llull & Poquet / L. lactis zit (ZitR zinc regulation) literature
- Bikard et al. 2013, NAR (CRISPRi); CRISPRi in lactic acid bacteria
- License
- Parts per their original sources; design template CC BY 4.0