Tryptophan sensor (TrpR + CRISPRi)
Detects tryptophan, a dietary amino acid and precursor of gut-microbial indole/serotonin metabolites. The classic TrpR repressor gates a CRISPRi circuit driving a fluorescent reporter, in the food-grade GRAS chassis Lactococcus lactis.
Clinical / gut biomarkerBSL-1 chassisGRAStemplateclinical-guttryptophanamino-acidmetabolitefoodGRASCRISPRi
Input
L-tryptophan
Clinical / gut biomarker
→
Sense
CRISPRi-repression
dCas9 (S. pyogenes, catalytically dead)
→
Chassis
Lactococcus lactis (MG1363)
BSL-1
→
Output
sfGFP
fluorescent
What it detects
- Analyte
- L-tryptophan — TrpR responds across µM-mM tryptophan
- Category
- Clinical / gut biomarker
- Signal
- Luminal/dietary tryptophan (precursor of indole and serotonin pathway metabolites)
Genetic circuit
⤢ click to enlarge
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
⤢ click to enlarge
CRISPR sensing mechanism
- Strategy
- CRISPRi-repression · NOT logic
- Cas protein
- dCas9 (S. pyogenes, catalytically dead)
- Analyte sensor
- TrpR binds tryptophan as co-repressor and represses the trp promoter.
Signal flow
Tryptophan -> Trp-TrpR represses Ptrp (so Ptrp drives the sgRNA only at LOW tryptophan); for a turn-on-with-tryptophan readout, route TrpR to gate a CRISPRi inverter. As drawn: tryptophan lowers sgRNA, de-repressing the reporter.Safe chassis
Lactococcus lactis (MG1363) — Lactococcus lactis
Food-grade, GRAS lactic acid bacterium used for centuries in dairy fermentation. Non-colonizing and ideal for ingestible / clinical biosensors where a food-safe, gut-transient host is wanted.
BSL-1GRAS · FDA GRAS for food useprobiotic
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| TrpR repressor Tryptophan co-repressor-activated; requires porting/codon-optimisation for L. lactis. | regulator | E. coli trpR (classic tryptophan repressor) |
| Ptrp promoter Repressed by Trp-bound TrpR. | promoter | E. coli trp operon promoter/operator |
| sgRNA | sgRNA | designed against the reporter promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| dCas9 | dCas9 | Qi et al. 2013 (CRISPRi) |
| sfGFP reporter | reporter | Pedelacq et al. 2006 |
Output & readout
- Type
- fluorescent
- Reporter
- sfGFP
- Readout
- Fluorescence (plate reader)
- Positive result
- Signal reports tryptophan level (via the TrpR/CRISPRi inversion).
Performance
- Limit of detection
- TrpR module: µM-mM tryptophan (module-validated).
- Dynamic range
- ~10 µM - 1 mM tryptophan
- Response time
- ~180 min
- Device validated
- No — design template (parts validated individually)
TrpR is one of the best-characterised repressors; integrated CRISPRi device is a design template. Choose inverter polarity to get a turn-on-with-tryptophan readout.
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- Yes
- Biocontainment
- thyA-based containment in L. lactis; food-grade host.
- Field-deployable
- Lab / supervised use
GRAS / food-grade chassis; research / supervised use.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Port + design Codon-optimise TrpR/Ptrp for L. lactis; design the sgRNA and choose inverter polarity. |
| 2 | assembly | Assemble units TU1: TrpR + Ptrp -> sgRNA. TU2: dCas9 + reporter. NICE vectors. |
| 3 | transformation | Transform L. lactis MG1363 Electroporate; select; add thyA containment. |
| 4 | induction | Expose to tryptophan Validate across a tryptophan standard curve. |
| 5 | readout | Measure fluorescence Interpolate tryptophan from the curve. |
Source & parts
- Design
- Design template combining the classic TrpR tryptophan repressor with L. lactis CRISPRi
- Parts validated in
- Yanofsky / TrpR tryptophan regulation (E. coli)
- Qi et al. 2013, Cell (CRISPRi)
- License
- Parts per their original sources; design template CC BY 4.0