Thiamine (B1) sensor (TPP riboswitch + CRISPRi)
Detects thiamine pyrophosphate (vitamin B1) in food and the gut using the natural TPP riboswitch — the most widespread riboswitch class — gating a CRISPRi circuit driving a fluorescent reporter, in probiotic Lactiplantibacillus plantarum.
Clinical / gut biomarkerBSL-1 chassisGRAStemplatethiaminevitamin-B1TPPmicronutrientfoodclinical-gutriboswitchprobioticCRISPRi
Input
Thiamine pyrophosphate (vitamin B1)
Clinical / gut biomarker
→
Sense
CRISPRi-repression
dCas9 (S. pyogenes, catalytically dead)
→
Chassis
Lactiplantibacillus plantarum (WCFS1)
BSL-1
→
Output
sfGFP
fluorescent
What it detects
- Analyte
- Thiamine pyrophosphate (vitamin B1) — TPP riboswitch responds at nM-µM
- Category
- Clinical / gut biomarker
- Signal
- Thiamine/TPP in food, supplements, and the gut
Genetic circuit
⤢ click to enlarge
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
⤢ click to enlarge
CRISPR sensing mechanism
- Strategy
- CRISPRi-repression · NOT logic
- Cas protein
- dCas9 (S. pyogenes, catalytically dead)
- Analyte sensor
- The natural TPP riboswitch binds thiamine pyrophosphate and modulates downstream expression.
Signal flow
TPP/B1 -> TPP riboswitch gates an anti-reporter sgRNA -> CRISPRi inverts a constitutive reporter (NOT). Choose polarity for a turn-on-with-B1 readout.Safe chassis
Lactiplantibacillus plantarum (WCFS1) — Lactiplantibacillus plantarum
A GRAS probiotic lactic acid bacterium that persists in the gut better than L. lactis. Robust to gut bile and acid, making it a strong chassis for ingestible clinical/gut biosensors and fermented-food monitoring.
BSL-1GRAS · EFSA QPSprobiotic
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| TPP riboswitch Most widespread natural riboswitch; place upstream of the sgRNA. | rbs | Natural TPP (THI-box) riboswitch (Winkler/Breaker) |
| sgRNA (riboswitch-controlled) | sgRNA | designed against the reporter promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| P11 constitutive promoter | promoter | L. plantarum constitutive promoter |
| dCas9 | dCas9 | CRISPRi in lactobacilli |
| sfGFP reporter | reporter | Pedelacq et al. 2006 |
Output & readout
- Type
- fluorescent
- Reporter
- sfGFP
- Readout
- Fluorescence (plate reader)
- Positive result
- Signal reports thiamine level (via the riboswitch/CRISPRi inversion).
Performance
- Device validated
- No — design template (parts validated individually)
The TPP riboswitch is the most widespread natural riboswitch; integrated CRISPRi device is a design template.
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- Yes
- Biocontainment
- Auxotrophy and food-grade containment; GRAS probiotic host.
- Field-deployable
- Lab / supervised use
GRAS, gut-persistent probiotic.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Design sgRNA Target/position the sgRNA; check L. plantarum WCFS1 off-targets. |
| 2 | assembly | Assemble units Sensor -> sgRNA; dCas9; reporter. Use the host's standard toolkit. |
| 3 | transformation | Transform L. plantarum WCFS1 Transform, select, and confirm low background. |
| 4 | induction | Expose to sample Incubate with the sample plus a thiamine standard curve. |
| 5 | readout | Read result Relate signal to concentration. |
Source & parts
- Design
- Design template combining the natural TPP riboswitch with L. plantarum CRISPRi
- Parts validated in
- Winkler/Breaker (TPP riboswitch)
- Bikard et al. 2013, NAR (CRISPRi/a)
- License
- Parts per their original sources; design template CC BY 4.0