Streptococcus sensor (CSP/ComD + CRISPRa)
Detects Streptococcus via its competence-stimulating peptide (CSP). The ComD/ComE quorum system gates a CRISPRa circuit driving a fluorescent reporter, in the food-grade Gram-positive chassis Lactococcus lactis.
Pathogen signalBSL-1 chassisGRAStemplatepathogenStreptococcusCSPquorum-sensingpeptideGRASCRISPRa
Input
Competence-stimulating peptide (CSP)
Pathogen signal
→
Sense
CRISPRa-activation
dCas9-ω (CRISPRa activator)
→
Chassis
Lactococcus lactis (MG1363)
BSL-1
→
Output
mCherry
fluorescent
What it detects
- Analyte
- Competence-stimulating peptide (CSP) — ComD responds from nM CSP
- Category
- Pathogen signal
- Signal
- The CSP quorum peptide secreted by streptococci (e.g. S. pneumoniae, S. mutans)
Genetic circuit
⤢ click to enlarge
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
⤢ click to enlarge
CRISPR sensing mechanism
- Strategy
- CRISPRa-activation · amplifier logic
- Cas protein
- dCas9-ω (CRISPRa activator)
- Analyte sensor
- The ComD histidine kinase detects CSP and phosphorylates ComE, which activates competence promoters (PcomX/PcomC).
Signal flow
CSP -> ComD/ComE activates a com promoter -> transcribes an sgRNA -> dCas9-activator amplifies a fluorescent reporter (CRISPRa) -> fluorescence when Streptococcus signal is present.Safe chassis
Lactococcus lactis (MG1363) — Lactococcus lactis
Food-grade, GRAS lactic acid bacterium used for centuries in dairy fermentation. Non-colonizing and ideal for ingestible / clinical biosensors where a food-safe, gut-transient host is wanted.
BSL-1GRAS · FDA GRAS for food useprobiotic
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| ComD/ComE two-component system CSP-responsive sensor kinase + activator; Gram-positive peptide signalling fits L. lactis. | regulator | Streptococcus com quorum system |
| com promoter (PcomX) Activated by phospho-ComE. | promoter | Streptococcus competence regulon |
| Reporter-activating sgRNA | sgRNA | designed for CRISPRa upstream of a weak reporter promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| dCas9-ω activator | dCas9 | Bikard et al. 2013 (CRISPRa) |
| mCherry reporter | reporter | standard fluorophore |
Output & readout
- Type
- fluorescent
- Reporter
- mCherry
- Readout
- Fluorescence (plate reader)
- Positive result
- Fluorescence indicates streptococcal CSP in the sample.
Performance
- Limit of detection
- ComD CSP sensing: nM range (module-validated).
- Dynamic range
- ~1-1000 nM CSP
- Response time
- ~240 min
- Device validated
- No — design template (parts validated individually)
Senses the pathogen's peptide signal, not the live organism; ComD/ComE and CRISPRa are validated separately and integration is a design template (requires porting com into L. lactis).
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- Yes
- Biocontainment
- Safe GRAS L. lactis reads a secreted peptide; no streptococcal culture required.
- Field-deployable
- Lab / supervised use
Food-grade chassis; indirect, safe detection.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Port com + design sgRNA Reconstitute ComD/ComE in L. lactis; design the CRISPRa sgRNA. |
| 2 | assembly | Assemble units TU1: ComD/ComE. TU2: PcomX -> sgRNA. TU3: dCas9-omega. TU4: weak promoter -> mCherry. NICE vectors. |
| 3 | transformation | Transform L. lactis MG1363 Electroporate; select; add thyA containment; validate CSP response. |
| 4 | induction | Add sample Incubate with the sample + synthetic CSP standard curve. |
| 5 | readout | Measure fluorescence Interpolate from the curve. |
Source & parts
- Design
- Design template combining the Streptococcus ComD/CSP quorum module with L. lactis CRISPRa
- Parts validated in
- Streptococcus competence (com) quorum-sensing literature
- Bikard et al. 2013, NAR (CRISPRa)
- License
- Parts per their original sources; design template CC BY 4.0