Riboflavin (B2) sensor (FMN riboswitch + CRISPRa)
Detects riboflavin / FMN (vitamin B2) in food and the gut. The natural FMN riboswitch gates a CRISPRa circuit driving a fluorescent reporter, in the gut-persistent probiotic Lactiplantibacillus plantarum.
Clinical / gut biomarkerBSL-1 chassisGRAStemplateriboflavinvitamin-B2FMNmicronutrientfoodclinical-gutriboswitchprobioticCRISPRa
Input
Riboflavin / FMN (vitamin B2)
Clinical / gut biomarker
→
Sense
CRISPRa-activation
dCas9-ω (CRISPRa activator)
→
Chassis
Lactiplantibacillus plantarum (WCFS1)
BSL-1
→
Output
mCherry
fluorescent
What it detects
- Analyte
- Riboflavin / FMN (vitamin B2) — FMN riboswitch responds at nM-µM
- Category
- Clinical / gut biomarker
- Signal
- Riboflavin/FMN in food, supplements, and the gut
Genetic circuit
⤢ click to enlarge
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
⤢ click to enlarge
CRISPR sensing mechanism
- Strategy
- CRISPRa-activation · BUFFER logic
- Cas protein
- dCas9-ω (CRISPRa activator)
- Analyte sensor
- The natural FMN riboswitch binds flavin mononucleotide and modulates downstream expression.
Signal flow
FMN/B2 -> FMN riboswitch gates sgRNA expression -> dCas9-activator amplifies the reporter (CRISPRa) -> fluorescence reports B2 level.Safe chassis
Lactiplantibacillus plantarum (WCFS1) — Lactiplantibacillus plantarum
A GRAS probiotic lactic acid bacterium that persists in the gut better than L. lactis. Robust to gut bile and acid, making it a strong chassis for ingestible clinical/gut biosensors and fermented-food monitoring.
BSL-1GRAS · EFSA QPSprobiotic
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| FMN riboswitch Place upstream of the sgRNA. | rbs | Natural FMN (RFN) riboswitch (Winkler/Breaker) |
| sgRNA (riboswitch-controlled) | sgRNA | designed for CRISPRa upstream of a weak promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| P11 constitutive promoter Drives the riboswitch-sgRNA transcript. | promoter | L. plantarum constitutive promoter |
| dCas9-ω activator | dCas9 | CRISPRa (Bikard et al. 2013); CRISPRi in lactobacilli |
| mCherry reporter | reporter | standard fluorophore |
Output & readout
- Type
- fluorescent
- Reporter
- mCherry
- Readout
- Fluorescence (plate reader)
- Positive result
- Fluorescence increases with riboflavin.
Performance
- Device validated
- No — design template (parts validated individually)
The FMN riboswitch is a well-characterised natural B2 sensor; integrated CRISPRa device is a design template. L. plantarum itself produces riboflavin (food-fortification relevance).
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- Yes
- Biocontainment
- Auxotrophy (alr/dapA) and food-grade containment; GRAS probiotic host.
- Field-deployable
- Lab / supervised use
GRAS, gut-persistent probiotic.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Design sgRNA Target/position the sgRNA; check L. plantarum WCFS1 off-targets. |
| 2 | assembly | Assemble units Sensor -> sgRNA; dCas9; reporter. Use the host's standard toolkit. |
| 3 | transformation | Transform L. plantarum WCFS1 Transform, select, and confirm low background. |
| 4 | induction | Expose to sample Incubate with the sample plus a riboflavin standard curve. |
| 5 | readout | Read result Relate signal to concentration. |
Source & parts
- Design
- Design template combining the natural FMN riboswitch with L. plantarum CRISPRa
- Parts validated in
- Winkler/Breaker (FMN riboswitch)
- Bikard et al. 2013, NAR (CRISPRa)
- License
- Parts per their original sources; design template CC BY 4.0