Naringenin/flavonoid sensor (FdeR + CRISPRa)
Detects naringenin and related flavonoids (dietary and nutraceutical compounds). The Marionette FdeR sensor gates a CRISPRa circuit driving a fluorescent reporter, in the food-grade GRAS chassis Lactococcus lactis.
Chemical / metaboliteBSL-1 chassisGRAStemplatenaringeninflavonoidnutraceuticalfoodchemicalMarionetteGRASCRISPRa
Input
Naringenin (flavonoid)
Chemical / metabolite
→
Sense
CRISPRa-activation
dCas9-ω (CRISPRa activator)
→
Chassis
Lactococcus lactis (MG1363)
BSL-1
→
Output
mCherry
fluorescent
What it detects
- Analyte
- Naringenin (flavonoid) — FdeR responds across µM naringenin
- Category
- Chemical / metabolite
- Signal
- Naringenin/flavonoids in food, beverages, and fermentation
Genetic circuit
⤢ click to enlarge
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
⤢ click to enlarge
CRISPR sensing mechanism
- Strategy
- CRISPRa-activation · amplifier logic
- Cas protein
- dCas9-ω (CRISPRa activator)
- Analyte sensor
- FdeR (LysR family) activates its promoter on binding naringenin.
Signal flow
Naringenin -> FdeR activates PfdeA -> transcribes an sgRNA -> dCas9-activator amplifies a fluorescent reporter (CRISPRa) -> fluorescence rises with naringenin.Safe chassis
Lactococcus lactis (MG1363) — Lactococcus lactis
Food-grade, GRAS lactic acid bacterium used for centuries in dairy fermentation. Non-colonizing and ideal for ingestible / clinical biosensors where a food-safe, gut-transient host is wanted.
BSL-1GRAS · FDA GRAS for food useprobiotic
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| FdeR regulator Naringenin-responsive LysR-family activator. | regulator | Marionette sensor (Meyer et al. 2019); Herbaspirillum fde system |
| PfdeA promoter Activated by naringenin-bound FdeR. | promoter | fde operon promoter |
| Reporter-activating sgRNA | sgRNA | designed for CRISPRa upstream of a weak reporter promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| dCas9-ω activator | dCas9 | Bikard et al. 2013 (CRISPRa) |
| mCherry reporter | reporter | standard fluorophore |
Output & readout
- Type
- fluorescent
- Reporter
- mCherry
- Readout
- Fluorescence (plate reader)
- Positive result
- Fluorescence increases with naringenin.
Performance
- Limit of detection
- FdeR Marionette sensor: µM naringenin (module-validated).
- Dynamic range
- ~1-100 µM naringenin
- Response time
- ~180 min
- Device validated
- No — design template (parts validated individually)
FdeR is a characterised orthogonal Marionette sensor; integrated CRISPRa device is a design template (requires porting to L. lactis).
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- Yes
- Biocontainment
- thyA-based containment in L. lactis; food-grade host.
- Field-deployable
- Lab / supervised use
GRAS / food-grade chassis; suited to food and nutraceutical screening.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Port + design Codon-optimise FdeR/PfdeA for L. lactis; design the CRISPRa sgRNA. |
| 2 | assembly | Assemble units TU1: FdeR + PfdeA -> sgRNA. TU2: dCas9-omega. TU3: weak promoter -> mCherry. NICE vectors. |
| 3 | transformation | Transform L. lactis MG1363 Electroporate; select; add thyA containment. |
| 4 | induction | Expose to sample Add food sample + naringenin standard curve. |
| 5 | readout | Measure fluorescence Interpolate naringenin from the curve. |
Source & parts
- Design
- Design template combining the Marionette FdeR naringenin sensor with L. lactis CRISPRa
- Parts validated in
- Meyer et al. 2019, Nat. Chem. Biol. (Marionette sensors, FdeR)
- Bikard et al. 2013, NAR (CRISPRa)
- License
- Parts per their original sources; design template CC BY 4.0