Lactate sensor (LldR + CRISPRi)
Detects L-lactate, a fermentation and clinical metabolite. The LldR lactate-responsive regulator gates a CRISPRa circuit driving a fluorescent reporter, in the food-grade GRAS chassis Lactococcus lactis.
What it detects
- Analyte
- L-lactate — LldR-based sensors respond across physiological lactate (low mM)
- Category
- Chemical / metabolite
- Signal
- L-lactate in fermentation, food, or clinical samples
Genetic circuit
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
CRISPR sensing mechanism
- Strategy
- CRISPRa-activation · amplifier logic
- Cas protein
- dCas9-ω (CRISPRa activator)
- Analyte sensor
- LldR de-represses / activates its target promoter (Plld) in response to L-lactate.
Safe chassis
Food-grade, GRAS lactic acid bacterium used for centuries in dairy fermentation. Non-colonizing and ideal for ingestible / clinical biosensors where a food-safe, gut-transient host is wanted.
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| LldR regulator Lactate-responsive regulator; requires porting/codon-optimisation for L. lactis. | regulator | E. coli lldPRD operon (GntR/FadR family) |
| Plld promoter Modulated by LldR under lactate. | promoter | lldPRD operator/promoter |
| Reporter-activating sgRNA | sgRNA | designed upstream of a weak reporter promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| dCas9-ω activator | dCas9 | CRISPRa (Bikard et al. 2013); CRISPRi demonstrated in lactic acid bacteria |
| mCherry / GFP reporter Food-compatible fluorescent readout. | reporter | standard fluorophores |
Output & readout
- Type
- fluorescent
- Reporter
- mCherry
- Readout
- Fluorescence (plate reader)
- Positive result
- Fluorescence rises with L-lactate concentration.
Performance
- Limit of detection
- LldR module: low-mM lactate (module-validated in E. coli).
- Dynamic range
- ~0.1-10 mM L-lactate
- Response time
- ~180 min
- Device validated
- No — design template (parts validated individually)
LldR lactate sensing and CRISPRa are validated separately; the integrated device in L. lactis is a design template and the sensor module needs porting to the GRAS host.
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- Yes
- Biocontainment
- thyA-based biological containment demonstrated in L. lactis; food-grade host.
- Field-deployable
- Lab / supervised use
GRAS / food-grade chassis (no LPS endotoxin); suited to food-fermentation monitoring and ingestible research applications.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Port + design Codon-optimise LldR/Plld for L. lactis; design the CRISPRa sgRNA. |
| 2 | assembly | Assemble units TU1: LldR. TU2: Plld -> sgRNA. TU3: dCas9-omega. TU4: weak promoter -> mCherry. Use NICE-compatible vectors. |
| 3 | transformation | Transform L. lactis MG1363 Electroporate; select (ErmR/CmR); add thyA containment. |
| 4 | induction | Expose to lactate Validate across a lactate standard curve. |
| 5 | readout | Measure fluorescence Interpolate lactate from the curve. |
Source & parts
- Design
- Design template combining an LldR lactate-sensing module with L. lactis CRISPRa
- Parts validated in
- Aguilera et al. 2008 / E. coli lldPRD (LldR lactate sensing)
- Bikard et al. 2013, NAR (CRISPRa); CRISPRi in lactic acid bacteria
- License
- Parts per their original sources; design template CC BY 4.0