Fluoride sensor (riboswitch + CRISPRa)
Detects fluoride in drinking water using a natural fluoride riboswitch as the sensor, gating a CRISPRa circuit driving a fluorescent reporter, in the food-grade GRAS chassis Lactococcus lactis.
Environmental contaminantBSL-1 chassisGRAStemplatefluoridewater-qualityriboswitchenvironmentalGRASCRISPRa
Input
Fluoride (F-)
Environmental contaminant
→
Sense
CRISPRa-activation
dCas9-ω (CRISPRa activator)
→
Chassis
Lactococcus lactis (MG1363)
BSL-1
→
Output
mCherry
fluorescent
What it detects
- Analyte
- Fluoride (F-) — Fluoride riboswitches respond over the high-µM to mM range
- Category
- Environmental contaminant
- Signal
- Fluoride in drinking water (relevant to the ~1.5 mg/L WHO guideline)
Genetic circuit
⤢ click to enlarge
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
⤢ click to enlarge
CRISPR sensing mechanism
- Strategy
- CRISPRa-activation · BUFFER logic
- Cas protein
- dCas9-ω (CRISPRa activator)
- Analyte sensor
- A natural fluoride (crcB) riboswitch in the 5' UTR binds fluoride and switches expression of its downstream gene ON.
Signal flow
F- -> fluoride riboswitch turns ON expression of an sgRNA -> dCas9-activator amplifies a weak reporter promoter (CRISPRa) -> fluorescence rises with fluoride.Safe chassis
Lactococcus lactis (MG1363) — Lactococcus lactis
Food-grade, GRAS lactic acid bacterium used for centuries in dairy fermentation. Non-colonizing and ideal for ingestible / clinical biosensors where a food-safe, gut-transient host is wanted.
BSL-1GRAS · FDA GRAS for food useprobiotic
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| Fluoride riboswitch (crcB class) RNA aptamer in the 5' UTR; fluoride binding switches expression on. Place upstream of the sgRNA. | rbs | Natural fluoride riboswitch (Baker et al. 2012, Science) |
| sgRNA (under riboswitch control) | sgRNA | designed for CRISPRa upstream of a weak reporter promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| dCas9-ω activator | dCas9 | Bikard et al. 2013 (CRISPRa) |
| Constitutive promoter (P32) Drives the riboswitch-sgRNA transcript. | promoter | L. lactis constitutive promoter |
| mCherry reporter Food-compatible fluorescent readout. | reporter | standard fluorophore |
Output & readout
- Type
- fluorescent
- Reporter
- mCherry
- Readout
- Fluorescence (plate reader)
- Positive result
- Fluorescence increases with fluoride concentration.
Performance
- Limit of detection
- Fluoride riboswitch: high-µM to mM (module-validated).
- Dynamic range
- ~0.1-5 mM fluoride
- Response time
- ~180 min
- Device validated
- No — design template (parts validated individually)
Uses an RNA riboswitch sensor rather than a protein regulator; the riboswitch and CRISPRa are validated separately and integration is a design template.
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- Yes
- Biocontainment
- thyA-based containment in L. lactis; food-grade host.
- Field-deployable
- Lab / supervised use
GRAS / food-grade chassis (no LPS endotoxin); relevant to drinking-water fluoride monitoring.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Design riboswitch-sgRNA transcript Place the fluoride riboswitch 5' of the sgRNA; design the CRISPRa spacer. |
| 2 | assembly | Assemble units TU1: P32 -> riboswitch -> sgRNA. TU2: dCas9-omega. TU3: weak promoter -> mCherry. Use NICE-compatible vectors. |
| 3 | transformation | Transform L. lactis MG1363 Electroporate; select; add thyA containment. |
| 4 | induction | Expose to fluoride Validate across a fluoride standard curve. |
| 5 | readout | Measure fluorescence Interpolate fluoride from the curve. |
Source & parts
- Design
- Design template combining a natural fluoride riboswitch with L. lactis CRISPRa
- Parts validated in
- Baker et al. 2012, Science (fluoride riboswitch)
- Bikard et al. 2013, NAR (CRISPRa)
- License
- Parts per their original sources; design template CC BY 4.0