Vitamin B12 sensor (cobalamin riboswitch + CRISPRa)
Detects vitamin B12 (cobalamin) in food and the gut. The natural cobalamin riboswitch gates a CRISPRa circuit driving a fluorescent reporter, in the gut-persistent probiotic Lactiplantibacillus plantarum.
Clinical / gut biomarkerBSL-1 chassisGRAStemplatevitamin-B12cobalaminmicronutrientfoodclinical-gutriboswitchprobioticCRISPRa
Input
Vitamin B12 (adenosylcobalamin)
Clinical / gut biomarker
→
Sense
CRISPRa-activation
dCas9-ω (CRISPRa activator)
→
Chassis
Lactiplantibacillus plantarum (WCFS1)
BSL-1
→
Output
mCherry
fluorescent
What it detects
- Analyte
- Vitamin B12 (adenosylcobalamin) — Cobalamin riboswitches respond at nM-µM B12
- Category
- Clinical / gut biomarker
- Signal
- Cobalamin in food, supplements, and the gut
Genetic circuit
⤢ click to enlarge
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
⤢ click to enlarge
CRISPR sensing mechanism
- Strategy
- CRISPRa-activation · BUFFER logic
- Cas protein
- dCas9-ω (CRISPRa activator)
- Analyte sensor
- The natural cobalamin (B12) riboswitch binds adenosylcobalamin and modulates downstream expression.
Signal flow
B12 -> cobalamin riboswitch gates sgRNA expression -> dCas9-activator amplifies a fluorescent reporter (CRISPRa) -> fluorescence reports B12 level.Safe chassis
Lactiplantibacillus plantarum (WCFS1) — Lactiplantibacillus plantarum
A GRAS probiotic lactic acid bacterium that persists in the gut better than L. lactis. Robust to gut bile and acid, making it a strong chassis for ingestible clinical/gut biosensors and fermented-food monitoring.
BSL-1GRAS · EFSA QPSprobiotic
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| Cobalamin (B12) riboswitch Widespread B12-binding RNA element; place upstream of the sgRNA. | rbs | Natural cobalamin riboswitch (btuB / cob class) |
| sgRNA (riboswitch-controlled) | sgRNA | designed for CRISPRa upstream of a weak promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| P11 constitutive promoter Drives the riboswitch-sgRNA transcript. | promoter | L. plantarum constitutive promoter |
| dCas9-ω activator | dCas9 | CRISPRa (Bikard et al. 2013); CRISPRi in lactobacilli |
| mCherry reporter | reporter | standard fluorophore |
Output & readout
- Type
- fluorescent
- Reporter
- mCherry
- Readout
- Fluorescence (plate reader)
- Positive result
- Fluorescence increases with vitamin B12.
Performance
- Limit of detection
- Cobalamin riboswitch: nM-µM B12 (module-validated).
- Dynamic range
- ~1 nM - 1 µM B12
- Response time
- ~180 min
- Device validated
- No — design template (parts validated individually)
The cobalamin riboswitch is a well-characterised natural B12 sensor; integrated CRISPRa device is a design template. Relevant to food fortification and B12-deficiency contexts.
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- Yes
- Biocontainment
- Auxotrophy (alr/dapA) and food-grade containment; GRAS probiotic host.
- Field-deployable
- Lab / supervised use
GRAS, gut-persistent probiotic; suited to food and ingestible sensing.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Design riboswitch-sgRNA Place the cobalamin riboswitch 5' of the sgRNA; design the CRISPRa spacer. |
| 2 | assembly | Assemble units TU1: P11 -> riboswitch -> sgRNA. TU2: dCas9-omega. TU3: weak promoter -> mCherry. pSIP vectors. |
| 3 | transformation | Transform L. plantarum WCFS1 Electroporate; select; add food-grade containment. |
| 4 | induction | Expose to sample Add food/gut sample + B12 standard curve. |
| 5 | readout | Measure fluorescence Interpolate B12 from the curve. |
Source & parts
- Design
- Design template combining the natural cobalamin riboswitch with L. plantarum CRISPRa
- Parts validated in
- Nahvi/Breaker (cobalamin riboswitch)
- Bikard et al. 2013, NAR (CRISPRa)
- License
- Parts per their original sources; design template CC BY 4.0