Gut acid/pH sensor (GadE + CRISPRa)
Reports gut acidity / low pH (linked to short-chain-fatty-acid load and dysbiosis). The acid-responsive Gad system gates a CRISPRa circuit driving a fluorescent reporter, in the food-grade acid-tolerant chassis Lactococcus lactis.
Clinical / gut biomarkerBSL-1 chassisGRAStemplateclinical-gutpHacidSCFAfoodGRASCRISPRa
Input
Acid / low pH
Clinical / gut biomarker
→
Sense
CRISPRa-activation
dCas9-ω (CRISPRa activator)
→
Chassis
Lactococcus lactis (MG1363)
BSL-1
→
Output
mCherry
fluorescent
What it detects
- Analyte
- Acid / low pH — Gad acid-response activates below ~pH 5.5
- Category
- Clinical / gut biomarker
- Signal
- Luminal acidity (low pH from short-chain fatty acids / fermentation)
Genetic circuit
⤢ click to enlarge
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
⤢ click to enlarge
CRISPR sensing mechanism
- Strategy
- CRISPRa-activation · amplifier logic
- Cas protein
- dCas9-ω (CRISPRa activator)
- Analyte sensor
- The GadE/GadX acid-response activator switches on glutamate-dependent acid-resistance promoters (PgadA/PgadB) at low pH.
Signal flow
Low pH -> GadE activates PgadA -> transcribes an sgRNA -> dCas9-activator amplifies a fluorescent reporter (CRISPRa) -> fluorescence rises as the environment acidifies.Safe chassis
Lactococcus lactis (MG1363) — Lactococcus lactis
Food-grade, GRAS lactic acid bacterium used for centuries in dairy fermentation. Non-colonizing and ideal for ingestible / clinical biosensors where a food-safe, gut-transient host is wanted.
BSL-1GRAS · FDA GRAS for food useprobiotic
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| GadE/GadX acid regulator Acid-responsive activator; requires porting/adapting for L. lactis (itself acid-tolerant). | regulator | E. coli glutamate-dependent acid resistance (gad regulon) |
| PgadA promoter Activated under acid stress. | promoter | E. coli gadA promoter |
| Reporter-activating sgRNA | sgRNA | designed for CRISPRa upstream of a weak reporter promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| dCas9-ω activator | dCas9 | Bikard et al. 2013 (CRISPRa) |
| mCherry reporter | reporter | standard fluorophore |
Output & readout
- Type
- fluorescent
- Reporter
- mCherry
- Readout
- Fluorescence (plate reader / flow cytometry)
- Positive result
- Fluorescence increases as pH drops.
Performance
- Limit of detection
- Gad acid response activates below ~pH 5.5 (module-validated).
- Dynamic range
- ~pH 4.5-6.5
- Response time
- ~150 min
- Device validated
- No — design template (parts validated individually)
The Gad acid response and CRISPRa are validated separately; integrated device is a design template. L. lactis is natively acid-tolerant, suiting low-pH gut/food settings.
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- Yes
- Biocontainment
- thyA-based containment in L. lactis; food-grade host.
- Field-deployable
- Lab / supervised use
GRAS / food-grade chassis; research / supervised use.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Adapt + design Adapt the acid-responsive promoter for L. lactis; design the CRISPRa sgRNA. |
| 2 | assembly | Assemble units TU1: GadE + PgadA -> sgRNA. TU2: dCas9-omega. TU3: weak promoter -> mCherry. NICE vectors. |
| 3 | transformation | Transform L. lactis MG1363 Electroporate; select; add thyA containment. |
| 4 | induction | Expose to low pH Validate across a pH series. |
| 5 | readout | Measure fluorescence Relate signal to pH. |
Source & parts
- Design
- Design template combining the Gad acid-response module with L. lactis CRISPRa
- Parts validated in
- Foster / E. coli glutamate-dependent acid resistance (GadE/GadX)
- Bikard et al. 2013, NAR (CRISPRa)
- License
- Parts per their original sources; design template CC BY 4.0