Zinc-limitation/calprotectin sensor (Zur + CRISPRa)
An ingestible sensor for host nutritional immunity: the host inflammation protein calprotectin sequesters zinc, and the Zur zinc-uptake regulator reports the resulting zinc limitation. Zur gates a CRISPRa circuit driving a fluorescent reporter, in the probiotic E. coli Nissle 1917.
Clinical / gut biomarkerBSL-1 chassistemplateclinical-gutinflammationcalprotectinzinc-limitationnutritional-immunityprobioticNissleCRISPRa
Input
Zinc limitation (calprotectin proxy)
Clinical / gut biomarker
→
Sense
CRISPRa-activation
dCas9-ω (CRISPRa activator)
→
Chassis
E. coli Nissle 1917
BSL-1
→
Output
sfGFP
fluorescent
What it detects
- Analyte
- Zinc limitation (calprotectin proxy) — Zur de-represses uptake genes under zinc starvation
- Category
- Clinical / gut biomarker
- Signal
- Host-imposed zinc sequestration by calprotectin during inflammation
Genetic circuit
⤢ click to enlarge
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
⤢ click to enlarge
CRISPR sensing mechanism
- Strategy
- CRISPRa-activation · amplifier logic
- Cas protein
- dCas9-ω (CRISPRa activator)
- Analyte sensor
- Zur (Fur-family) represses zinc-uptake promoters (e.g. PznuA) when zinc is replete and releases them under zinc limitation.
Signal flow
Zinc limitation (calprotectin) -> Zur releases PznuA -> transcribes an sgRNA -> dCas9-activator amplifies a fluorescent reporter (CRISPRa) -> fluorescence reports inflammation-driven zinc sequestration.Safe chassis
E. coli Nissle 1917 — Escherichia coli
A probiotic E. coli used in humans for over a century (Mutaflor). Colonizes the gut safely, making it the chassis of choice for clinical / gut biomarker biosensors.
BSL-1probiotic
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| Zur regulator Zinc-responsive repressor; endogenous to E. coli Nissle. | regulator | Native E. coli zur (Fur family) |
| PznuA promoter De-repressed under zinc limitation. | promoter | E. coli znuABC uptake promoter |
| Reporter-activating sgRNA | sgRNA | designed for CRISPRa upstream of a weak reporter promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| dCas9-ω activator | dCas9 | Bikard et al. 2013 (CRISPRa) |
| sfGFP reporter Recoverable from stool for non-invasive readout. | reporter | Pedelacq et al. 2006 |
Output & readout
- Type
- fluorescent
- Reporter
- sfGFP
- Readout
- Fluorescence (flow cytometry on recovered cells)
- Positive result
- Signal reports zinc limitation (calprotectin / inflammation).
Performance
- Limit of detection
- Zur module reports zinc starvation (module-validated).
- Dynamic range
- Zinc-replete to -limited transition
- Response time
- ~180 min
- Device validated
- No — design template (parts validated individually)
Reports zinc limitation as a proxy for calprotectin-driven nutritional immunity; Zur and CRISPRa are validated separately and integration is a design template.
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- No
- Biocontainment
- Probiotic E. coli Nissle host; add thyA/dapA auxotrophy for gut-restricted containment.
- Field-deployable
- Lab / supervised use
Probiotic chassis with a human-safety record; research / supervised clinical use only.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Design CRISPRa sgRNA Target a weak reporter promoter; check Nissle off-targets. |
| 2 | assembly | Assemble units TU1: PznuA -> sgRNA (native Zur). TU2: dCas9-omega. TU3: weak promoter -> sfGFP. Low-copy vector. |
| 3 | transformation | Transform E. coli Nissle 1917 Select; add auxotrophic containment. |
| 4 | induction | Validate in vitro Confirm response across a zinc-limitation series before any animal work. |
| 5 | readout | Recover and measure Recover cells from stool; quantify fluorescence. |
Source & parts
- Design
- Design template combining the native E. coli Zur zinc-limitation sensor with a dCas9 CRISPRa circuit in E. coli Nissle
- Parts validated in
- Patzer & Hantke / Zur zinc-uptake regulation (E. coli)
- Bikard et al. 2013, NAR (CRISPRa)
- License
- Parts per their original sources; design template CC BY 4.0