Zinc band-pass sensor (healthy-window)

Fires only when zinc sits within a target concentration window — not too low, not too high — using an incoherent feed-forward loop. Useful for flagging deviations from a healthy/optimal range rather than mere presence.

Chemical / metaboliteband-pass circuitBSL-1 chassistemplatezincband-passwindowmicronutrientchemicalCRISPRi

Open in designer Design guide RNA

Input

Zinc Zn(II)

Chemical / metabolite

→

Sense

CRISPRi-repression

dCas9 (S. pyogenes, catalytically dead)

→

Chassis

E. coli K-12 (MG1655)

BSL-1

→

Output

sfGFP

fluorescent

What it detects

band-pass design — responds only within a concentration window.

Analyte: Zinc Zn(II) — Tunable pass-band (e.g. ~1-50 µM) set by the two thresholds
Category: Chemical / metabolite
Signal: Zinc within a defined concentration window

Genetic circuit

⤢ click to enlarge

Genetic construct (SBOL)

The DNA construct as transcription units, drawn with SBOL Visual part glyphs.

⤢ click to enlarge

CRISPR sensing mechanism

Strategy: CRISPRi-repression · NOT logic
Cas protein: dCas9 (S. pyogenes, catalytically dead)
Analyte sensor: Two zinc-responsive elements with different thresholds: a low-threshold ZntR activator turns the reporter ON; a high-threshold arm drives a CRISPRi sgRNA that turns it back OFF.

Signal flow

Low zinc -> reporter OFF (below low threshold). Mid zinc -> ZntR ON, high arm not yet active -> reporter ON (in band). High zinc -> CRISPRi sgRNA represses the reporter -> OFF (above high threshold). Net: ON only inside the window (incoherent feed-forward loop).

Safe chassis

E. coli K-12 (MG1655) — Escherichia coli

The non-pathogenic laboratory workhorse. K-12 strains have lost the ability to colonize the human gut and are the reference BSL-1 host for genetic engineering, with the deepest tooling of any bacterial chassis.

BSL-1

Genetic parts

Part	Role	Source / id
ZntR + PzntA (low-threshold ON arm) Turns the reporter on above the low threshold.	regulator	E. coli zinc-responsive activator
High-threshold zinc element -> sgRNA Drives the CRISPRi sgRNA above the high threshold.	promoter	second zinc-responsive promoter with a higher set-point
Anti-reporter sgRNA	sgRNA	designed against the reporter promoter
sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC	sgRNA	Standard SpCas9 scaffold
dCas9	dCas9	Qi et al. 2013 (CRISPRi)
sfGFP reporter	reporter	Pedelacq et al. 2006

Output & readout

Type: fluorescent
Reporter: sfGFP
Readout: Green fluorescence (plate reader)
Positive result: Fluorescence peaks within the zinc window and falls off outside it.

Performance

Device validated: No — design template (parts validated individually)

Band-pass / incoherent feed-forward circuits are validated as a topology (Basu et al. 2005); this zinc-windowed CRISPRi version is a design template. Tune the two thresholds via promoter/operator strength.

Safety

Biosafety level: BSL-1 (non-pathogenic chassis)
GRAS chassis: No
Biocontainment: Lab/contained; add kill-switch for field use.
Field-deployable: Lab / supervised use

E. coli K-12 non-pathogenic BSL-1 host.

Build & run

#	Stage	Step
1	design	Set the two thresholds Tune the low (ON) and high (OFF) zinc set-points via operator affinity; design the sgRNA.
2	assembly	Assemble the feed-forward loop ON arm: ZntR -> reporter. OFF arm: high-threshold zinc promoter -> sgRNA + dCas9 -> represses reporter.
3	transformation	Transform E. coli K-12 Select; characterise the dose-response to confirm a band-pass shape.
4	induction	Zinc titration Run a full zinc dose-response to map the pass-band.
5	readout	Read window Signal present only within the target window.

Source & parts

Design

Design template: a zinc band-pass sensor (incoherent feed-forward loop) with a CRISPRi high-threshold arm

Parts validated in

Basu et al. 2005, Nature (band-pass / IFFL)
ZntR zinc sensing (E. coli)
Qi et al. 2013, Cell (CRISPRi)

License

Parts per their original sources; design template CC BY 4.0