Vibrio sensor (LuxR/3OC6-HSL + CRISPRa)
Detects Vibrio-type contamination via the 3-oxo-C6-homoserine-lactone quorum signal. The classic LuxR receptor gates a CRISPRa circuit driving a luminescent reporter, in safe E. coli K-12.
Pathogen signalBSL-1 chassistemplatepathogenVibrioAHL3OC6-HSLquorum-sensingwaterseafoodCRISPRaluminescent
Input
3-oxo-C6-homoserine lactone (3OC6-HSL)
Pathogen signal
→
Sense
CRISPRa-activation
dCas9-ω (CRISPRa activator)
→
Chassis
E. coli K-12 (MG1655)
BSL-1
→
Output
luxCDABE
luminescent
What it detects
- Analyte
- 3-oxo-C6-homoserine lactone (3OC6-HSL) — LuxR responds from low nM AHL
- Category
- Pathogen signal
- Signal
- The LuxI-type AHL quorum signal produced by Vibrio fischeri and related Vibrio species
Genetic circuit
⤢ click to enlarge
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
⤢ click to enlarge
CRISPR sensing mechanism
- Strategy
- CRISPRa-activation · amplifier logic
- Cas protein
- dCas9-ω (CRISPRa activator)
- Analyte sensor
- LuxR binds 3OC6-HSL and activates the Plux promoter.
Signal flow
3OC6-HSL -> LuxR activates Plux -> transcribes an sgRNA -> dCas9-activator amplifies a luminescent reporter (CRISPRa) -> luminescence when Vibrio AHL is present.Safe chassis
E. coli K-12 (MG1655) — Escherichia coli
The non-pathogenic laboratory workhorse. K-12 strains have lost the ability to colonize the human gut and are the reference BSL-1 host for genetic engineering, with the deepest tooling of any bacterial chassis.
BSL-1
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| LuxR receptor 3OC6-HSL-responsive activator; the canonical AHL sensor. | regulator | Vibrio fischeri lux operon |
| Plux promoter Activated by AHL-bound LuxR. | promoter | V. fischeri lux operon promoter |
| Reporter-activating sgRNA | sgRNA | designed for CRISPRa upstream of a weak luminescent reporter promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| dCas9-ω activator | dCas9 | Bikard et al. 2013 (CRISPRa) |
| luxCDABE operon Self-luminescent, no added substrate. | reporter | bacterial bioluminescence operon |
Output & readout
- Type
- luminescent
- Reporter
- luxCDABE
- Readout
- Bioluminescence (luminometer / camera)
- Positive result
- Luminescence indicates Vibrio-type AHL in the sample.
Performance
- Limit of detection
- LuxR AHL sensing: low-nM (module-validated).
- Dynamic range
- ~1-1000 nM 3OC6-HSL
- Response time
- ~180 min
- Device validated
- No — design template (parts validated individually)
LuxR/Plux is the canonical AHL sensor; integrated CRISPRa device is a design template. Detects the signal molecule, not a live organism.
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- No
- Biocontainment
- Safe E. coli K-12 reads a secreted small molecule; no Vibrio culture required.
- Field-deployable
- Yes (with containment)
Relevant to water and seafood-safety surveillance.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Design CRISPRa sgRNA Target a weak luminescent reporter promoter; check host off-targets. |
| 2 | assembly | Assemble units TU1: LuxR. TU2: Plux -> sgRNA. TU3: dCas9-omega. TU4: weak promoter -> luxCDABE. |
| 3 | transformation | Transform E. coli K-12 Select; confirm AHL-dependent activation. |
| 4 | induction | Add sample Incubate with the water/seafood rinse + AHL standard curve. |
| 5 | readout | Measure luminescence Interpolate from the curve. |
Source & parts
- Design
- Design template combining the LuxR/3OC6-HSL quorum module with E. coli CRISPRa
- Parts validated in
- Engebrecht & Silverman / lux quorum sensing (V. fischeri)
- Bikard et al. 2013, NAR (CRISPRa)
- License
- Parts per their original sources; design template CC BY 4.0