Vanillate sensor (VanR + CRISPRa)
Detects vanillate/vanillin (lignin-degradation and food/flavour marker). The Marionette VanR sensor gates a CRISPRa circuit driving a fluorescent reporter, in safe E. coli K-12.
Chemical / metaboliteBSL-1 chassistemplatevanillatevanillinligninfoodchemicalMarionetteCRISPRa
Input
Vanillic acid / vanillin
Chemical / metabolite
→
Sense
CRISPRa-activation
dCas9-ω (CRISPRa activator)
→
Chassis
E. coli K-12 (MG1655)
BSL-1
→
Output
sfGFP
fluorescent
What it detects
- Analyte
- Vanillic acid / vanillin — VanR responds across µM vanillate
- Category
- Chemical / metabolite
- Signal
- Vanillate in lignin-processing streams, food, and fermentation
Genetic circuit
⤢ click to enlarge
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
⤢ click to enlarge
CRISPR sensing mechanism
- Strategy
- CRISPRa-activation · amplifier logic
- Cas protein
- dCas9-ω (CRISPRa activator)
- Analyte sensor
- VanR de-represses the Pvan promoter on binding vanillate.
Signal flow
Vanillate -> VanR releases Pvan -> transcribes an sgRNA -> dCas9-activator amplifies a fluorescent reporter (CRISPRa) -> fluorescence rises with vanillate.Safe chassis
E. coli K-12 (MG1655) — Escherichia coli
The non-pathogenic laboratory workhorse. K-12 strains have lost the ability to colonize the human gut and are the reference BSL-1 host for genetic engineering, with the deepest tooling of any bacterial chassis.
BSL-1
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| VanR regulator Vanillate-responsive repressor, characterised as an orthogonal Marionette sensor. | regulator | Marionette sensor (Meyer et al. 2019); Caulobacter van system |
| Pvan promoter De-repressed by vanillate-bound VanR. | promoter | van operon promoter |
| Reporter-activating sgRNA | sgRNA | designed for CRISPRa upstream of a weak reporter promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| dCas9-ω activator | dCas9 | Bikard et al. 2013 (CRISPRa) |
| sfGFP | reporter | Pedelacq et al. 2006 |
Output & readout
- Type
- fluorescent
- Reporter
- sfGFP
- Readout
- Green fluorescence (plate reader)
- Positive result
- Fluorescence increases with vanillate.
Performance
- Limit of detection
- VanR Marionette sensor: µM vanillate (module-validated).
- Dynamic range
- ~1-100 µM vanillate
- Response time
- ~150 min
- Device validated
- No — design template (parts validated individually)
VanR is a characterised orthogonal Marionette sensor; integrated CRISPRa device is a design template.
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- No
- Biocontainment
- Lab/contained; add kill-switch for field use.
- Field-deployable
- Lab / supervised use
E. coli K-12 non-pathogenic BSL-1 host.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Design CRISPRa sgRNA Target a weak reporter promoter; check host off-targets. |
| 2 | assembly | Assemble units TU1: VanR + Pvan -> sgRNA. TU2: dCas9-omega. TU3: weak promoter -> sfGFP. |
| 3 | transformation | Transform E. coli K-12 Select; confirm vanillate-dependent activation. |
| 4 | induction | Expose to sample Add sample + vanillate standard curve. |
| 5 | readout | Measure fluorescence Interpolate vanillate from the curve. |
Source & parts
- Design
- Design template combining the Marionette VanR vanillate sensor with E. coli CRISPRa
- Parts validated in
- Meyer et al. 2019, Nat. Chem. Biol. (Marionette sensors, VanR)
- Bikard et al. 2013, NAR (CRISPRa)
- License
- Parts per their original sources; design template CC BY 4.0