Toluene/BTEX sensor (XylR + CRISPRi)
Detects toluene and related BTEX aromatic pollutants. The native XylR/Pu regulator gates a CRISPRi circuit driving a visible pigment, in P. putida KT2440 — a natural toluene-degrader and rugged environmental chassis.
Environmental contaminantBSL-1 chassistemplatetolueneBTEXaromaticpollutantsoilwaterenvironmentalCRISPRi
Input
Toluene (and BTEX aromatics)
Environmental contaminant
→
Sense
CRISPRi-repression
dCas9 (S. pyogenes, catalytically dead)
→
Chassis
Pseudomonas putida KT2440
BSL-1
→
Output
amilCP
pigment
What it detects
- Analyte
- Toluene (and BTEX aromatics) — XylR/Pu responds across µM toluene
- Category
- Environmental contaminant
- Signal
- Toluene / benzene-toluene-ethylbenzene-xylene contamination in soil and groundwater
Genetic circuit
⤢ click to enlarge
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
⤢ click to enlarge
CRISPR sensing mechanism
- Strategy
- CRISPRi-repression · NOT logic
- Cas protein
- dCas9 (S. pyogenes, catalytically dead)
- Analyte sensor
- XylR binds toluene/m-xylene effectors and activates the Pu promoter (sigma-54 dependent).
Signal flow
Toluene -> XylR activates Pu -> transcribes an anti-pigment sgRNA -> dCas9 + sgRNA repress a constitutive amilCP cassette (CRISPRi) -> pigment fades with toluene (NOT); pair an inverter for colour-on.Safe chassis
Pseudomonas putida KT2440 — Pseudomonas putida
A certified safety-strain soil bacterium with exceptional solvent/stress tolerance and diverse metabolism. The premier chassis for environmental biosensing of pollutants and heavy metals in soil and water.
BSL-1
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| XylR regulator Toluene/xylene-responsive sigma-54 activator; native effector range in P. putida. | regulator | Pseudomonas putida TOL plasmid (pWW0) |
| Pu promoter Activated by effector-bound XylR. | promoter | TOL plasmid upper-pathway promoter |
| Anti-pigment sgRNA | sgRNA | designed against the amilCP promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| dCas9 | dCas9 | CRISPRi (established in P. putida) |
| amilCP chromoprotein Naked-eye pigment. | reporter | BBa_K592009 |
Output & readout
- Type
- pigment
- Reporter
- amilCP
- Readout
- Visible pigment (naked eye / smartphone)
- Positive result
- Pigment change reports toluene/BTEX contamination.
Performance
- Limit of detection
- XylR/Pu module: µM toluene (module-validated).
- Dynamic range
- ~1-100 µM toluene
- Response time
- ~180 min
- Device validated
- No — design template (parts validated individually)
XylR/Pu is a classic, well-characterised aromatic sensor native to P. putida; the CRISPRi integration is a design template.
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- No
- Biocontainment
- P. putida KT2440 is a certified HV1 safety host; add a containment circuit for field use.
- Field-deployable
- Yes (with containment)
Ideal match: P. putida natively tolerates and metabolises aromatics, so it works in real contaminated samples.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Design anti-pigment sgRNA Target the amilCP promoter; check host off-targets. |
| 2 | assembly | Assemble units TU1: XylR. TU2: Pu -> sgRNA. TU3: dCas9 + constitutive amilCP. Clone into SEVA vectors. |
| 3 | transformation | Transform P. putida KT2440 Electroporate; select; confirm baseline pigment without toluene. |
| 4 | induction | Expose to sample Add soil eluate / groundwater + toluene standard curve. |
| 5 | readout | Score colour Compare pigment to the curve. |
Source & parts
- Design
- Design template combining the native XylR/Pu toluene-sensing module with P. putida CRISPRi
- Parts validated in
- Ramos et al. / TOL plasmid XylR-Pu literature (toluene sensing in P. putida)
- iGEM Uppsala amilCP (BBa_K592009)
- License
- Parts per their original sources; design template CC BY 4.0