Theophylline sensor (riboswitch + CRISPRa)

Detects theophylline, an asthma drug with a narrow therapeutic window. The well-characterized synthetic theophylline riboswitch gates a CRISPRa circuit driving a fluorescent reporter, in safe E. coli K-12 — a model for low-cost therapeutic drug monitoring.

Clinical / gut biomarkerBSL-1 chassistemplatetheophyllinedrug-monitoringriboswitchclinical-gutCRISPRa

Open in designer Design guide RNA

Input

Theophylline

Clinical / gut biomarker

→

Sense

CRISPRa-activation

dCas9-ω (CRISPRa activator)

→

Chassis

E. coli K-12 (MG1655)

BSL-1

→

Output

sfGFP

fluorescent

What it detects

Analyte: Theophylline — Theophylline riboswitches respond across µM-mM
Category: Clinical / gut biomarker
Signal: Theophylline (therapeutic drug monitoring; narrow therapeutic index)

Genetic circuit

⤢ click to enlarge

Genetic construct (SBOL)

The DNA construct as transcription units, drawn with SBOL Visual part glyphs.

⤢ click to enlarge

CRISPR sensing mechanism

Strategy: CRISPRa-activation · BUFFER logic
Cas protein: dCas9-ω (CRISPRa activator)
Analyte sensor: The synthetic theophylline aptamer riboswitch in the 5' UTR switches expression ON when theophylline binds.

Signal flow

Theophylline -> riboswitch turns ON sgRNA expression -> dCas9-activator amplifies a fluorescent reporter (CRISPRa) -> fluorescence rises with drug concentration.

Safe chassis

E. coli K-12 (MG1655) — Escherichia coli

The non-pathogenic laboratory workhorse. K-12 strains have lost the ability to colonize the human gut and are the reference BSL-1 host for genetic engineering, with the deepest tooling of any bacterial chassis.

BSL-1

Genetic parts

Part	Role	Source / id
Theophylline riboswitch Highly selective for theophylline over caffeine; place upstream of the sgRNA.	rbs	Synthetic theophylline aptamer riboswitch (Suess / Breaker)
sgRNA (riboswitch-controlled)	sgRNA	designed for CRISPRa upstream of a weak reporter promoter
sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC	sgRNA	Standard SpCas9 scaffold
Constitutive promoter (J23119) Drives the riboswitch-sgRNA transcript. TTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGC	promoter	BBa_J23119
dCas9-ω activator	dCas9	Bikard et al. 2013 (CRISPRa)
sfGFP	reporter	Pedelacq et al. 2006

Output & readout

Type: fluorescent
Reporter: sfGFP
Readout: Green fluorescence (plate reader)
Positive result: Fluorescence increases with theophylline.

Performance

Limit of detection: Theophylline riboswitch: µM-mM (module-validated).
Dynamic range: ~10 µM - 1 mM
Response time: ~150 min
Device validated: No — design template (parts validated individually)

The theophylline riboswitch is a gold-standard synthetic RNA sensor; integrated CRISPRa device is a design template. Highly selective against caffeine.

Safety

Biosafety level: BSL-1 (non-pathogenic chassis)
GRAS chassis: No
Biocontainment: Lab/contained; add kill-switch for field use.
Field-deployable: Lab / supervised use

E. coli K-12 non-pathogenic BSL-1 host; model for therapeutic drug monitoring.

Build & run

#	Stage	Step
1	design	Design riboswitch-sgRNA Place the theophylline riboswitch 5' of the sgRNA; design the CRISPRa spacer.
2	assembly	Assemble units TU1: J23119 -> riboswitch -> sgRNA. TU2: dCas9-omega. TU3: weak promoter -> sfGFP.
3	transformation	Transform E. coli K-12 Select; confirm theophylline-dependent activation; check caffeine specificity.
4	induction	Expose to sample Add sample + theophylline standard curve.
5	readout	Measure fluorescence Interpolate theophylline from the curve.

Source & parts

Design

Design template combining the synthetic theophylline riboswitch with E. coli CRISPRa

Parts validated in

Suess / Breaker (theophylline riboswitch)
Bikard et al. 2013, NAR (CRISPRa)

License

Parts per their original sources; design template CC BY 4.0