Gut inflammation memory sensor (tetrathionate + CRISPRi)
An ingestible sensor for tetrathionate, a biomarker of gut inflammation. The validated TtrSR sensor gates a CRISPRi circuit driving a fluorescent reporter, in the probiotic E. coli Nissle 1917. Complements the thiosulfate sensor as a second inflammation marker.
Clinical / gut biomarkerBSL-1 chassistemplateclinical-gutinflammationtetrathionateprobioticNissleCRISPRi
Input
Tetrathionate (S4O6 2-)
Clinical / gut biomarker
→
Sense
CRISPRi-repression
dCas9 (S. pyogenes, catalytically dead)
→
Chassis
E. coli Nissle 1917
BSL-1
→
Output
sfGFP
fluorescent
What it detects
- Analyte
- Tetrathionate (S4O6 2-) — TtrSR responds over physiological inflamed-gut tetrathionate levels (validated in mouse colitis)
- Category
- Clinical / gut biomarker
- Signal
- Tetrathionate, produced during intestinal inflammation
Genetic circuit
⤢ click to enlarge
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
⤢ click to enlarge
CRISPR sensing mechanism
- Strategy
- CRISPRi-repression · NOT logic
- Cas protein
- dCas9 (S. pyogenes, catalytically dead)
- Analyte sensor
- The TtrS sensor kinase activates the response regulator TtrR in response to tetrathionate, turning on its target promoter.
Signal flow
Tetrathionate -> TtrS/TtrR activates PttrR -> transcribes an anti-reporter sgRNA -> CRISPRi inverts a constitutive reporter (NOT), or pair with a memory switch (cI/Cro) for a persistent record of an inflammation episode.Safe chassis
E. coli Nissle 1917 — Escherichia coli
A probiotic E. coli used in humans for over a century (Mutaflor). Colonizes the gut safely, making it the chassis of choice for clinical / gut biomarker biosensors.
BSL-1probiotic
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| TtrS/TtrR two-component system Tetrathionate sensor; validated in vivo in mouse gut. | regulator | ported to E. coli Nissle by Daeffler et al. 2017 / Riglar et al. 2017 |
| PttrR target promoter Activated by phospho-TtrR. | promoter | Riglar et al. 2017 |
| Anti-reporter sgRNA | sgRNA | designed against the reporter promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| dCas9 | dCas9 | Qi et al. 2013 (CRISPRi) |
| sfGFP / mCherry reporter Recoverable from stool for non-invasive readout. | reporter | standard fluorophores |
Output & readout
- Type
- fluorescent
- Reporter
- sfGFP
- Readout
- Fluorescence (flow cytometry on recovered cells)
- Positive result
- Fluorescent-cell fraction reflects gut tetrathionate / inflammation.
Performance
- Limit of detection
- TtrSR module validated in vivo (mouse gut inflammation).
- Dynamic range
- Physiological inflamed-gut tetrathionate range
- Response time
- ~240 min
- Device validated
- No — design template (parts validated individually)
The tetrathionate sensor (with a genetic memory switch) is validated in vivo by Riglar et al.; the CRISPRi integration here is a design template. Pairs with the thiosulfate sensor for two-marker inflammation sensing.
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- No
- Biocontainment
- Built in probiotic E. coli Nissle; add thyA/dapA auxotrophy for gut-restricted containment.
- Field-deployable
- Lab / supervised use
Probiotic chassis with a human-safety record; research / supervised clinical use only.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Design sgRNA (and optional memory switch) Target the reporter promoter; optionally add a cI/Cro memory element to record transient inflammation. |
| 2 | assembly | Assemble units TU1: TtrS/TtrR. TU2: PttrR -> sgRNA. TU3: dCas9 + reporter. Use a stable low-copy vector. |
| 3 | transformation | Transform E. coli Nissle 1917 Select; add auxotrophic containment. |
| 4 | induction | Validate in vitro Confirm tetrathionate response across a standard curve before any animal work. |
| 5 | readout | Recover and measure Recover cells from stool; quantify fluorescence. |
Source & parts
- Design
- Design template combining the validated TtrSR tetrathionate sensor in E. coli Nissle with a dCas9 CRISPRi circuit
- Parts validated in
- Riglar et al. 2017, Nat. Biotechnol. (tetrathionate memory sensor in Nissle)
- Daeffler et al. 2017, Mol. Syst. Biol. (sulfur-compound sensors)
- Qi et al. 2013, Cell (CRISPRi)
- License
- Parts per their original sources; design template CC BY 4.0