S. aureus sensor (AIP/AgrC + CRISPRa)
Detects Staphylococcus aureus by sensing its autoinducing peptide (AIP). The AgrC/AgrA quorum receptor gates a CRISPRa circuit driving a fluorescent reporter, in safe Gram-positive Bacillus subtilis 168 — no live pathogen handled.
Pathogen signalBSL-1 chassisGRAStemplatepathogenStaphylococcus aureusAIPquorum-sensingpeptideCRISPRa
Input
Autoinducing peptide (AIP)
Pathogen signal
→
Sense
CRISPRa-activation
dCas9-ω (CRISPRa activator)
→
Chassis
Bacillus subtilis 168
BSL-1
→
Output
sfGFP
fluorescent
What it detects
- Analyte
- Autoinducing peptide (AIP) — AgrC responds from nM AIP
- Category
- Pathogen signal
- Signal
- The agr autoinducing peptide secreted by S. aureus
Genetic circuit
⤢ click to enlarge
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
⤢ click to enlarge
CRISPR sensing mechanism
- Strategy
- CRISPRa-activation · amplifier logic
- Cas protein
- dCas9-ω (CRISPRa activator)
- Analyte sensor
- The AgrC histidine kinase detects AIP and phosphorylates AgrA, which activates the agr P2/P3 promoters.
Signal flow
AIP -> AgrC/AgrA activates P3 -> transcribes an sgRNA -> dCas9-activator amplifies a fluorescent reporter (CRISPRa) -> fluorescence when S. aureus signal is present.Safe chassis
Bacillus subtilis 168 — Bacillus subtilis
Gram-positive, spore-forming model bacterium with QPS (EFSA) status and a long history of safe industrial use. Spores make it robust for field-deployable and environmental biosensors.
BSL-1GRAS · EFSA Qualified Presumption of Safety (QPS)
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| AgrC/AgrA two-component system AIP-responsive sensor kinase + activator; Gram-positive peptide signalling fits B. subtilis. | regulator | S. aureus agr operon |
| agr P3 promoter Activated by phospho-AgrA. | promoter | S. aureus agr locus |
| Reporter-activating sgRNA | sgRNA | designed for CRISPRa upstream of a weak reporter promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| dCas9-ω activator | dCas9 | Bikard et al. 2013 (CRISPRa) |
| sfGFP | reporter | Pedelacq et al. 2006 |
Output & readout
- Type
- fluorescent
- Reporter
- sfGFP
- Readout
- Green fluorescence (plate reader)
- Positive result
- Fluorescence indicates S. aureus quorum signal in the sample.
Performance
- Limit of detection
- AgrC AIP sensing: nM range (module-validated).
- Dynamic range
- ~1-1000 nM AIP
- Response time
- ~240 min
- Device validated
- No — design template (parts validated individually)
Senses the pathogen's peptide signal, not the live organism; AgrC/AgrA and CRISPRa are validated separately and integration is a design template (requires porting agr into B. subtilis).
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- Yes
- Biocontainment
- Safe GRAS B. subtilis reads a secreted peptide; no S. aureus culture required.
- Field-deployable
- Lab / supervised use
Indirect, safe detection — a key advantage of signal-molecule sensing.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Port agr + design sgRNA Reconstitute AgrC/AgrA in B. subtilis; design the CRISPRa sgRNA. |
| 2 | assembly | Assemble units TU1: AgrC/AgrA. TU2: P3 -> sgRNA. TU3: dCas9-omega. TU4: weak promoter -> sfGFP. |
| 3 | transformation | Transform B. subtilis 168 Natural competence; select; validate AIP-dependent activation. |
| 4 | induction | Add sample Incubate with the sample + synthetic AIP standard curve. |
| 5 | readout | Measure fluorescence Interpolate from the curve. |
Source & parts
- Design
- Design template combining the S. aureus AgrC/AIP quorum module with B. subtilis CRISPRa
- Parts validated in
- Novick & Geisinger 2008 / agr quorum sensing (S. aureus)
- Bikard et al. 2013, NAR (CRISPRa)
- License
- Parts per their original sources; design template CC BY 4.0