Salicylate sensor (NahR + CRISPRi)
Detects salicylate (a naphthalene-degradation marker and drug metabolite). The NahR LysR-family activator gates a CRISPRi circuit driving a visible pigment, in safe E. coli K-12.
Environmental contaminantBSL-1 chassistemplatesalicylatenaphthalenepollutantchemicalenvironmentalCRISPRichromoprotein
Input
Salicylate
Environmental contaminant
→
Sense
CRISPRi-repression
dCas9 (S. pyogenes, catalytically dead)
→
Chassis
E. coli K-12 (MG1655)
BSL-1
→
Output
amilCP
pigment
What it detects
- Analyte
- Salicylate — NahR responds across µM salicylate
- Category
- Environmental contaminant
- Signal
- Salicylate in water (naphthalene/PAH degradation intermediate; also a drug metabolite)
Genetic circuit
⤢ click to enlarge
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
⤢ click to enlarge
CRISPR sensing mechanism
- Strategy
- CRISPRi-repression · NOT logic
- Cas protein
- dCas9 (S. pyogenes, catalytically dead)
- Analyte sensor
- NahR (LysR family) binds salicylate and activates the Psal/Pnah promoters.
Signal flow
Salicylate -> NahR activates Psal -> transcribes an anti-pigment sgRNA -> CRISPRi represses a constitutive amilCP cassette -> pigment fades with salicylate (NOT). Pair an inverter for colour-on.Safe chassis
E. coli K-12 (MG1655) — Escherichia coli
The non-pathogenic laboratory workhorse. K-12 strains have lost the ability to colonize the human gut and are the reference BSL-1 host for genetic engineering, with the deepest tooling of any bacterial chassis.
BSL-1
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| NahR regulator Salicylate-responsive activator. | regulator | Pseudomonas NAH7 plasmid (LysR family) |
| Psal promoter Activated by salicylate-bound NahR. | promoter | NAH7 sal operon promoter |
| Anti-pigment sgRNA | sgRNA | designed against the amilCP promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| dCas9 | dCas9 | Qi et al. 2013 (CRISPRi) |
| amilCP chromoprotein | reporter | BBa_K592009 |
Output & readout
- Type
- pigment
- Reporter
- amilCP
- Readout
- Visible pigment (naked eye / smartphone)
- Positive result
- Pigment change reports salicylate.
Performance
- Limit of detection
- NahR module: µM salicylate (module-validated).
- Dynamic range
- ~1-100 µM salicylate
- Response time
- ~180 min
- Device validated
- No — design template (parts validated individually)
NahR is a classic, well-characterised salicylate sensor; integrated CRISPRi device is a design template.
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- No
- Biocontainment
- Lab/contained; add kill-switch for field use.
- Field-deployable
- Yes (with containment)
Instrument-free pigment readout.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Design anti-pigment sgRNA Target the amilCP promoter; check host off-targets. |
| 2 | assembly | Assemble units TU1: NahR + Psal -> sgRNA. TU2: dCas9 + constitutive amilCP. |
| 3 | transformation | Transform E. coli K-12 Select; confirm baseline pigment without salicylate. |
| 4 | induction | Expose to sample Add sample + salicylate standard curve. |
| 5 | readout | Score colour Compare pigment to the curve. |
Source & parts
- Design
- Design template combining the NahR salicylate-sensing module with E. coli CRISPRi
- Parts validated in
- Schell / NahR salicylate regulation (NAH7)
- Qi et al. 2013, Cell (CRISPRi)
- License
- Parts per their original sources; design template CC BY 4.0