P. aeruginosa sensor (PQS/PqsR + CRISPRi)
Detects Pseudomonas aeruginosa via its quinolone signal (PQS). The PqsR (MvfR) receptor gates a CRISPRi circuit driving a visible pigment, in the safe Pseudomonas relative P. putida KT2440.
Pathogen signalBSL-1 chassistemplatepathogenPseudomonas aeruginosaPQSquinolonequorum-sensingCRISPRi
Input
Pseudomonas quinolone signal (PQS)
Pathogen signal
→
Sense
CRISPRi-repression
dCas9 (S. pyogenes, catalytically dead)
→
Chassis
Pseudomonas putida KT2440
BSL-1
→
Output
amilCP
pigment
What it detects
- Analyte
- Pseudomonas quinolone signal (PQS) — PqsR responds from sub-µM PQS
- Category
- Pathogen signal
- Signal
- The PQS quorum signal secreted by P. aeruginosa (complements its AHL signal)
Genetic circuit
⤢ click to enlarge
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
⤢ click to enlarge
CRISPR sensing mechanism
- Strategy
- CRISPRi-repression · NOT logic
- Cas protein
- dCas9 (S. pyogenes, catalytically dead)
- Analyte sensor
- PqsR (MvfR) binds PQS and activates the pqsA promoter.
Signal flow
PQS -> PqsR activates PpqsA -> transcribes an anti-pigment sgRNA -> CRISPRi represses a constitutive amilCP cassette -> pigment fades when the pathogen signal is present (NOT). Pair an inverter for colour-on.Safe chassis
Pseudomonas putida KT2440 — Pseudomonas putida
A certified safety-strain soil bacterium with exceptional solvent/stress tolerance and diverse metabolism. The premier chassis for environmental biosensing of pollutants and heavy metals in soil and water.
BSL-1
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| PqsR (MvfR) receptor PQS-responsive LysR-family activator; works in the related P. putida host. | regulator | P. aeruginosa pqs system |
| PpqsA promoter Activated by PQS-bound PqsR. | promoter | P. aeruginosa pqsABCDE promoter |
| Anti-pigment sgRNA | sgRNA | designed against the amilCP promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| dCas9 | dCas9 | CRISPRi (established in P. putida) |
| amilCP chromoprotein | reporter | BBa_K592009 |
Output & readout
- Type
- pigment
- Reporter
- amilCP
- Readout
- Visible pigment (naked eye / smartphone)
- Positive result
- Colour change indicates P. aeruginosa PQS in the sample.
Performance
- Limit of detection
- PqsR PQS sensing: sub-µM (module-validated).
- Dynamic range
- ~0.1-10 µM PQS
- Response time
- ~240 min
- Device validated
- No — design template (parts validated individually)
Senses the pathogen's signal molecule, not the live organism; PqsR and CRISPRi are validated separately and integration is a design template.
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- No
- Biocontainment
- Safe P. putida reads a secreted small molecule; no P. aeruginosa culture required.
- Field-deployable
- Yes (with containment)
Indirect, safe detection in a related non-pathogenic Pseudomonas.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Design anti-pigment sgRNA Target the amilCP promoter; check host off-targets. |
| 2 | assembly | Assemble units TU1: PqsR + PpqsA -> sgRNA. TU2: dCas9 + constitutive amilCP. SEVA vectors. |
| 3 | transformation | Transform P. putida KT2440 Electroporate; select; confirm baseline pigment without PQS. |
| 4 | induction | Add sample Incubate with the filtered sample + PQS standard curve. |
| 5 | readout | Score colour Compare pigment to the curve. |
Source & parts
- Design
- Design template combining the P. aeruginosa PqsR/PQS quorum module with P. putida CRISPRi
- Parts validated in
- Pesci et al. / PQS quorum sensing (P. aeruginosa)
- Qi et al. 2013, Cell (CRISPRi)
- License
- Parts per their original sources; design template CC BY 4.0