Phosphate sensor (PhoPR + CRISPRa)
Reports phosphate status (relevant to water-quality and eutrophication monitoring). The native B. subtilis PhoP/PhoR phosphate-starvation system gates a CRISPRa circuit driving a fluorescent reporter, in spore-forming Bacillus subtilis 168.
Chemical / metaboliteBSL-1 chassisGRAStemplatephosphatewater-qualityeutrophicationchemicalCRISPRaspore
Input
Inorganic phosphate (Pi)
Chemical / metabolite
→
Sense
CRISPRa-activation
dCas9-ω (CRISPRa activator)
→
Chassis
Bacillus subtilis 168
BSL-1
→
Output
sfGFP
fluorescent
What it detects
- Analyte
- Inorganic phosphate (Pi) — PhoPR responds across phosphate-limited to -replete transition
- Category
- Chemical / metabolite
- Signal
- Phosphate availability in water/soil (low-phosphate triggers the Pho response)
Genetic circuit
⤢ click to enlarge
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
⤢ click to enlarge
CRISPR sensing mechanism
- Strategy
- CRISPRa-activation · amplifier logic
- Cas protein
- dCas9-ω (CRISPRa activator)
- Analyte sensor
- Under phosphate limitation the PhoR sensor kinase phosphorylates PhoP, which activates Pho-regulon promoters (e.g. PphoA/Ppst).
Signal flow
Low Pi -> PhoR/PhoP activates a Pho promoter -> transcribes an sgRNA -> dCas9-activator amplifies a fluorescent reporter (CRISPRa) -> fluorescence reports phosphate-starvation state.Safe chassis
Bacillus subtilis 168 — Bacillus subtilis
Gram-positive, spore-forming model bacterium with QPS (EFSA) status and a long history of safe industrial use. Spores make it robust for field-deployable and environmental biosensors.
BSL-1GRAS · EFSA Qualified Presumption of Safety (QPS)
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| PhoP/PhoR two-component system Phosphate-starvation sensor; endogenous to B. subtilis. | regulator | Native B. subtilis pho regulon |
| Pho-regulon promoter (e.g. PphoA) Activated by phospho-PhoP under low phosphate. | promoter | B. subtilis phoA/pst promoter |
| Reporter-activating sgRNA | sgRNA | designed for CRISPRa upstream of a weak reporter promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| dCas9-ω activator | dCas9 | Bikard et al. 2013 (CRISPRa) |
| sfGFP | reporter | Pedelacq et al. 2006 |
Output & readout
- Type
- fluorescent
- Reporter
- sfGFP
- Readout
- Green fluorescence (field fluorimeter)
- Positive result
- Fluorescence reflects phosphate-starvation signalling.
Performance
- Limit of detection
- PhoPR module reports the phosphate-limited transition (module-validated).
- Dynamic range
- Phosphate-limited to -replete transition
- Response time
- ~180 min
- Device validated
- No — design template (parts validated individually)
Reports phosphate status (inverse to abundance); integrated CRISPRa device is a design template. Best used as a relative phosphate-status reporter.
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- Yes
- Biocontainment
- GRAS, spore-forming host; auxotrophic/spore containment.
- Field-deployable
- Yes (with containment)
Spores allow ambient storage; relevant to surface-water eutrophication surveys.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Design CRISPRa sgRNA Target the activation window of a weak reporter promoter; check B. subtilis off-targets. |
| 2 | assembly | Assemble units TU1: Pho promoter -> sgRNA (native PhoPR). TU2: dCas9-omega. TU3: weak promoter -> sfGFP. Integrate at amyE/thrC. |
| 3 | transformation | Transform B. subtilis 168 Use natural competence; select; calibrate vs phosphate-replete/limited media. |
| 4 | induction | Expose to sample Reconstitute spores; add sample + phosphate standard curve. |
| 5 | readout | Measure fluorescence Interpolate relative phosphate from the curve. |
Source & parts
- Design
- Design template combining the native B. subtilis PhoPR phosphate system with CRISPRa
- Parts validated in
- Hulett et al. / B. subtilis Pho regulon (PhoP/PhoR) literature
- Bikard et al. 2013, NAR (CRISPRa)
- License
- Parts per their original sources; design template CC BY 4.0