Self-powered phosphate sensor (SphS/SphR + CRISPRa)

A self-powered sensor for phosphate status in water (eutrophication-relevant). The native cyanobacterial SphS/SphR phosphate two-component system gates a CRISPRa circuit driving a fluorescent reporter, in photosynthetic Synechocystis.

Environmental contaminantBSL-1 chassistemplatephosphateeutrophicationwater-qualityenvironmentalself-poweredcyanobacteriaCRISPRa

Open in designer Design guide RNA

Input

Inorganic phosphate (Pi)

Environmental contaminant

→

Sense

CRISPRa-activation

dCas9-ω (CRISPRa activator)

→

Chassis

Synechocystis sp. PCC 6803

BSL-1

→

Output

sfGFP

fluorescent

What it detects

Analyte: Inorganic phosphate (Pi) — SphS/SphR responds across the phosphate-limited transition
Category: Environmental contaminant
Signal: Phosphate availability in water (low Pi triggers the Pho response)

Genetic circuit

⤢ click to enlarge

Genetic construct (SBOL)

The DNA construct as transcription units, drawn with SBOL Visual part glyphs.

⤢ click to enlarge

CRISPR sensing mechanism

Strategy: CRISPRa-activation · amplifier logic
Cas protein: dCas9-ω (CRISPRa activator)
Analyte sensor: Under phosphate limitation SphS phosphorylates SphR, activating Pho-regulon promoters (e.g. PpstS).

Signal flow

Low Pi -> SphS/SphR activates a Pho promoter -> sgRNA -> dCas9-activator amplifies the reporter (CRISPRa) -> fluorescence reports phosphate status. Self-powered.

Safe chassis

Synechocystis sp. PCC 6803 — Synechocystis sp.

A non-pathogenic photosynthetic cyanobacterium. It runs on light and CO2, so biosensors built in it are self-powered — ideal for long-term, deployable environmental and water-quality monitoring without added nutrients.

BSL-1

Genetic parts

Part	Role	Source / id
SphS/SphR two-component system	regulator	Native Synechocystis sph (Pho regulon)
PpstS promoter	promoter	Synechocystis pst promoter
sgRNA	sgRNA	designed against / upstream of the reporter promoter
sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC	sgRNA	Standard SpCas9 scaffold
dCas9-ω activator	dCas9	Synechocystis CRISPRa (Yao et al. 2016 toolkit)
sfGFP	reporter	Pedelacq et al. 2006

Output & readout

Type: fluorescent
Reporter: sfGFP
Readout: Green fluorescence (field fluorimeter)
Positive result: Fluorescence reflects phosphate status.

Performance

Device validated: No — design template (parts validated individually)

SphS/SphR phosphate sensing and Synechocystis CRISPRi-a are validated separately; integrated device is a design template. Reports phosphate status (inverse to abundance).

Safety

Biosafety level: BSL-1 (non-pathogenic chassis)
GRAS chassis: No
Biocontainment: Light/CO2-dependent growth; add inducible-essential containment.
Field-deployable: Yes (with containment)

Self-powered; suited to surface-water eutrophication surveys.

Build & run

#	Stage	Step
1	design	Design sgRNA Target/position the sgRNA; check Synechocystis 6803 off-targets.
2	assembly	Assemble units Sensor -> sgRNA; dCas9; reporter. Use the host's standard toolkit.
3	transformation	Transform Synechocystis 6803 Transform, select, and confirm low background.
4	induction	Expose to sample Incubate with the sample plus a phosphate standard curve.
5	readout	Read result Relate signal to concentration.

Source & parts

Design

Design template combining the native Synechocystis SphS/SphR phosphate system with CRISPRa

Parts validated in

Hirani et al. / SphS-SphR phosphate regulation (Synechocystis)
Yao et al. 2016 (CRISPRi in Synechocystis)

License

Parts per their original sources; design template CC BY 4.0