Phenol sensor (DmpR + CRISPRa)
Detects phenol and methylphenols in water/soil. The DmpR aromatic sensor gates a CRISPRa circuit driving a fluorescent reporter, in the phenol-tolerant chassis P. putida KT2440.
Environmental contaminantBSL-1 chassistemplatephenolaromaticpollutantwatersoilenvironmentalCRISPRa
Input
Phenol / (methyl)phenols
Environmental contaminant
→
Sense
CRISPRa-activation
dCas9-ω (CRISPRa activator)
→
Chassis
Pseudomonas putida KT2440
BSL-1
→
Output
sfGFP
fluorescent
What it detects
- Analyte
- Phenol / (methyl)phenols — DmpR responds across µM phenol
- Category
- Environmental contaminant
- Signal
- Phenolic pollutants in industrial effluent and contaminated water
Genetic circuit
⤢ click to enlarge
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
⤢ click to enlarge
CRISPR sensing mechanism
- Strategy
- CRISPRa-activation · amplifier logic
- Cas protein
- dCas9-ω (CRISPRa activator)
- Analyte sensor
- DmpR is a sigma-54-dependent activator that binds phenol effectors and activates the Po promoter.
Signal flow
Phenol -> DmpR activates Po -> transcribes an sgRNA -> dCas9-activator amplifies a fluorescent reporter (CRISPRa) -> fluorescence rises with phenol.Safe chassis
Pseudomonas putida KT2440 — Pseudomonas putida
A certified safety-strain soil bacterium with exceptional solvent/stress tolerance and diverse metabolism. The premier chassis for environmental biosensing of pollutants and heavy metals in soil and water.
BSL-1
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| DmpR regulator Phenol/2-methylphenol-responsive activator. | regulator | Pseudomonas dmp operon (sigma-54 activator) |
| Po promoter Activated by effector-bound DmpR. | promoter | dmp operon promoter |
| Reporter-activating sgRNA | sgRNA | designed for CRISPRa upstream of a weak reporter promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| dCas9-ω activator | dCas9 | Bikard et al. 2013 (CRISPRa) |
| sfGFP | reporter | Pedelacq et al. 2006 |
Output & readout
- Type
- fluorescent
- Reporter
- sfGFP
- Readout
- Green fluorescence (field fluorimeter)
- Positive result
- Fluorescence increases with phenol concentration.
Performance
- Limit of detection
- DmpR module: µM phenol (module-validated).
- Dynamic range
- ~1-100 µM phenol
- Response time
- ~180 min
- Device validated
- No — design template (parts validated individually)
DmpR aromatic sensing and CRISPRa are validated separately; integrated device is a design template. P. putida natively tolerates aromatics.
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- No
- Biocontainment
- P. putida KT2440 certified HV1 safety host; add containment for field use.
- Field-deployable
- Yes (with containment)
Phenol-tolerant chassis works in real contaminated samples.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Design CRISPRa sgRNA Target a weak reporter promoter; check host off-targets. |
| 2 | assembly | Assemble units TU1: DmpR + Po -> sgRNA. TU2: dCas9-omega. TU3: weak promoter -> sfGFP. SEVA vectors. |
| 3 | transformation | Transform P. putida KT2440 Electroporate; select; confirm phenol-dependent activation. |
| 4 | induction | Expose to sample Add water/soil eluate + phenol standard curve. |
| 5 | readout | Measure fluorescence Interpolate phenol from the curve. |
Source & parts
- Design
- Design template combining the DmpR phenol-sensing module with P. putida CRISPRa
- Parts validated in
- Shingler et al. / DmpR phenol sensing (Pseudomonas dmp)
- Bikard et al. 2013, NAR (CRISPRa)
- License
- Parts per their original sources; design template CC BY 4.0