Oxidative-stress sensor (OxyR + CRISPRa)
An ingestible sensor for hydrogen peroxide / oxidative stress, a marker of gut inflammation. The native OxyR peroxide sensor gates a CRISPRa circuit driving a fluorescent reporter, in the probiotic E. coli Nissle 1917.
Clinical / gut biomarkerBSL-1 chassistemplateclinical-gutinflammationhydrogen-peroxideoxidative-stressprobioticNissleCRISPRa
Input
Hydrogen peroxide (H2O2) / oxidative stress
Clinical / gut biomarker
→
Sense
CRISPRa-activation
dCas9-ω (CRISPRa activator)
→
Chassis
E. coli Nissle 1917
BSL-1
→
Output
sfGFP
fluorescent
What it detects
- Analyte
- Hydrogen peroxide (H2O2) / oxidative stress — OxyR responds to low-µM H2O2
- Category
- Clinical / gut biomarker
- Signal
- Luminal hydrogen peroxide and reactive oxygen produced during gut inflammation
Genetic circuit
⤢ click to enlarge
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
⤢ click to enlarge
CRISPR sensing mechanism
- Strategy
- CRISPRa-activation · amplifier logic
- Cas protein
- dCas9-ω (CRISPRa activator)
- Analyte sensor
- OxyR is oxidized by H2O2 and, in its oxidized form, activates antioxidant promoters such as PkatG / PahpC.
Signal flow
H2O2 -> oxidized OxyR activates PahpC -> transcribes an sgRNA -> dCas9-activator amplifies a fluorescent reporter (CRISPRa) -> fluorescence reports oxidative stress.Safe chassis
E. coli Nissle 1917 — Escherichia coli
A probiotic E. coli used in humans for over a century (Mutaflor). Colonizes the gut safely, making it the chassis of choice for clinical / gut biomarker biosensors.
BSL-1probiotic
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| OxyR regulator H2O2-responsive transcriptional activator; endogenous to E. coli Nissle. | regulator | Native E. coli oxyR |
| PahpC / PkatG promoter Activated by oxidized OxyR. | promoter | E. coli OxyR-regulated antioxidant promoter |
| Reporter-activating sgRNA | sgRNA | designed for CRISPRa upstream of a weak reporter promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| dCas9-ω activator | dCas9 | Bikard et al. 2013 (CRISPRa) |
| sfGFP reporter Recoverable from stool for non-invasive readout. | reporter | Pedelacq et al. 2006 |
Output & readout
- Type
- fluorescent
- Reporter
- sfGFP
- Readout
- Fluorescence (flow cytometry on recovered cells)
- Positive result
- Fluorescent-cell fraction rises with luminal oxidative stress.
Performance
- Limit of detection
- OxyR module: low-µM H2O2 (module-validated).
- Dynamic range
- ~1-100 µM H2O2
- Response time
- ~120 min
- Device validated
- No — design template (parts validated individually)
OxyR peroxide sensing and CRISPRa are validated separately; integrated device is a design template. Complements the thiosulfate/tetrathionate inflammation sensors with an oxidative-stress marker.
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- No
- Biocontainment
- Probiotic E. coli Nissle host; add thyA/dapA auxotrophy for gut-restricted containment.
- Field-deployable
- Lab / supervised use
Probiotic chassis with a human-safety record; research / supervised clinical use only.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Design CRISPRa sgRNA Target the activation window of a weak reporter promoter; check Nissle off-targets. |
| 2 | assembly | Assemble units TU1: PahpC -> sgRNA (native OxyR). TU2: dCas9-omega. TU3: weak promoter -> sfGFP. Use a stable low-copy vector. |
| 3 | transformation | Transform E. coli Nissle 1917 Select; add auxotrophic containment. |
| 4 | induction | Validate with H2O2 Confirm peroxide-dependent activation across a standard curve before any animal work. |
| 5 | readout | Recover and measure Recover cells from stool; quantify fluorescence. |
Source & parts
- Design
- Design template combining the native OxyR peroxide sensor with a dCas9 CRISPRa circuit in E. coli Nissle
- Parts validated in
- Storz / Imlay OxyR peroxide-sensing literature
- Bikard et al. 2013, NAR (CRISPRa)
- License
- Parts per their original sources; design template CC BY 4.0