P. aeruginosa quorum sensor (LasR + CRISPRi)
Flags contamination by Pseudomonas aeruginosa by sensing its quorum-sensing signal 3-oxo-C12-HSL. The LasR sensor gates a CRISPRi inverter driving a pigment reporter, in safe E. coli K-12.
Pathogen signalBSL-1 chassistemplatepathogenPseudomonas aeruginosaquorum-sensingAHLwaterCRISPRicontamination
Input
3-oxo-C12-homoserine lactone (3-oxo-C12-HSL)
Pathogen signal
→
Sense
CRISPRi-repression
dCas9 (S. pyogenes, catalytically dead)
→
Chassis
E. coli K-12 (MG1655)
BSL-1
→
Output
amilCP (chromoprotein)
pigment
What it detects
- Analyte
- 3-oxo-C12-homoserine lactone (3-oxo-C12-HSL) — LasR sensors respond from low nM AHL
- Category
- Pathogen signal
- Signal
- The acyl-homoserine-lactone quorum signal secreted by Pseudomonas aeruginosa
Genetic circuit
⤢ click to enlarge
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
⤢ click to enlarge
CRISPR sensing mechanism
- Strategy
- CRISPRi-repression · NOT logic
- Cas protein
- dCas9 (S. pyogenes, catalytically dead)
- Analyte sensor
- LasR binds 3-oxo-C12-HSL and activates the pLas (PlasI) promoter.
Signal flow
AHL -> LasR activates pLas -> pLas transcribes an anti-pigment sgRNA -> CRISPRi represses a constitutive chromoprotein, OR (preferred turn-on) a paired inverter yields pigment-ON when the pathogen signal is present.Safe chassis
E. coli K-12 (MG1655) — Escherichia coli
The non-pathogenic laboratory workhorse. K-12 strains have lost the ability to colonize the human gut and are the reference BSL-1 host for genetic engineering, with the deepest tooling of any bacterial chassis.
BSL-1
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| LasR receptor 3-oxo-C12-HSL-responsive activator. | regulator | Marionette AHL sensor (LasR) |
| pLas promoter Activated by AHL-bound LasR. | promoter | P. aeruginosa lasI promoter (PlasI) |
| Anti-reporter sgRNA Transcribed from pLas. | sgRNA | designed against the chromoprotein promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| dCas9 | dCas9 | Qi et al. 2013, Cell (CRISPRi) |
| J23119 promoter Drives the reporter targeted by CRISPRi. TTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGC | promoter | BBa_J23119 |
| amilGFP / amilCP reporter Visible colour output. | reporter | iGEM chromoprotein collection |
Output & readout
- Type
- pigment
- Reporter
- amilCP (chromoprotein)
- Readout
- Visible pigment change (naked eye)
- Positive result
- Colour change indicates P. aeruginosa quorum signal in the sample.
Performance
- Limit of detection
- LasR AHL sensor module: low-nM 3-oxo-C12-HSL (module-validated, Marionette).
- Dynamic range
- ~1-1000 nM AHL
- Response time
- ~240 min
- Device validated
- No — design template (parts validated individually)
The LasR AHL sensor (Marionette) and CRISPRi are validated separately; the integrated device here is a design template. Detects the pathogen's signal molecule, not the live pathogen itself.
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- No
- Biocontainment
- Sensing is done by safe E. coli K-12 reading a secreted small molecule; no pathogen is handled or cultured.
- Field-deployable
- Lab / supervised use
Indirect, safe detection: the chassis senses an AHL signal, so no BSL-2 pathogen culture is required.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Design the anti-reporter sgRNA Target the chromoprotein promoter; check host off-targets. |
| 2 | assembly | Assemble units TU1: constitutive LasR. TU2: pLas -> sgRNA. TU3: dCas9 + J23119 -> reporter. Add a second inverter for turn-on output. |
| 3 | transformation | Transform E. coli K-12 Select and verify low background. |
| 4 | induction | Add sample Incubate with the filtered water/clinical sample and an AHL standard curve. |
| 5 | readout | Score colour Read pigment by eye or camera. |
Source & parts
- Design
- Design template combining the validated LasR AHL quorum-sensing module with a dCas9 CRISPRi reporter circuit
- Parts validated in
- Meyer et al. 2019, Nat. Chem. Biol. (Marionette LasR AHL sensor)
- Qi et al. 2013, Cell (CRISPRi)
- License
- Parts per their original sources; design template CC BY 4.0