Water nitrogen sensor (NtcA + CRISPRa)
A self-powered sensor for nitrogen status in water bodies (relevant to eutrophication and algal blooms). The native cyanobacterial NtcA nitrogen regulator gates a CRISPRa circuit driving a fluorescent reporter, in the photosynthetic chassis Synechocystis — which runs on light and CO2.
What it detects
- Analyte
- Nitrogen status (2-oxoglutarate / N limitation) — NtcA responds to the C/N balance via 2-oxoglutarate
- Category
- Environmental contaminant
- Signal
- Cellular nitrogen status, reporting nitrogen availability in water (eutrophication-relevant)
Genetic circuit
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
CRISPR sensing mechanism
- Strategy
- CRISPRa-activation · amplifier logic
- Cas protein
- dCas9-ω (CRISPRa activator)
- Analyte sensor
- NtcA, the global cyanobacterial nitrogen regulator, is activated by 2-oxoglutarate (high under nitrogen limitation) and turns on NtcA-dependent promoters.
Safe chassis
A non-pathogenic photosynthetic cyanobacterium. It runs on light and CO2, so biosensors built in it are self-powered — ideal for long-term, deployable environmental and water-quality monitoring without added nutrients.
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| NtcA regulator 2-oxoglutarate/nitrogen-status-responsive activator; endogenous. | regulator | Native Synechocystis ntcA (global nitrogen regulator) |
| NtcA-dependent promoter (e.g. PglnA) Activated by 2-OG-bound NtcA under N limitation. | promoter | Synechocystis NtcA-regulated promoter |
| Reporter-activating sgRNA | sgRNA | designed for CRISPRa upstream of a weak promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| dCas9-ω activator | dCas9 | Yao et al. 2016 / CRISPRi-a in Synechocystis |
| sfGFP | reporter | Pedelacq et al. 2006 |
Output & readout
- Type
- fluorescent
- Reporter
- sfGFP
- Readout
- Green fluorescence (field fluorimeter)
- Positive result
- Fluorescence reflects nitrogen status of the water.
Performance
- Limit of detection
- NtcA reports the cellular C/N balance (module-validated).
- Dynamic range
- Nitrogen-replete to -limited transition
- Response time
- ~720 min
- Device validated
- No — design template (parts validated individually)
NtcA nitrogen sensing and Synechocystis CRISPRi-a are validated separately; integrated device is a design template. Photoautotrophic chassis enables long-term, self-powered deployment.
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- No
- Biocontainment
- Light/CO2-dependent growth; add inducible-essential containment for outdoor use.
- Field-deployable
- Yes (with containment)
Self-powered (photosynthesis) — suited to long-term water-body monitoring.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Design CRISPRa sgRNA Target a weak promoter; check Synechocystis off-targets. |
| 2 | assembly | Assemble units TU1: NtcA promoter -> sgRNA (native NtcA). TU2: dCas9-omega. TU3: weak promoter -> sfGFP. Integrate at neutral sites; CyanoGate. |
| 3 | transformation | Transform Synechocystis 6803 Use natural transformation; select; segregate fully. |
| 4 | induction | Deploy / expose Expose to water + a nitrogen series under light. |
| 5 | readout | Measure fluorescence Relate signal to nitrogen status. |
Source & parts
- Design
- Design template combining the native Synechocystis NtcA nitrogen sensor with cyanobacterial CRISPRa
- Parts validated in
- Herrero et al. / NtcA nitrogen regulation (cyanobacteria)
- Yao et al. 2016 (CRISPRi in Synechocystis)
- License
- Parts per their original sources; design template CC BY 4.0