Gut nitric-oxide sensor (NsrR + CRISPRi)
An ingestible sensor for nitric oxide, a marker of intestinal inflammation. The native NsrR NO-sensing repressor gates a CRISPRi circuit driving a fluorescent reporter, in the probiotic E. coli Nissle 1917.
Clinical / gut biomarkerBSL-1 chassistemplateclinical-gutinflammationnitric-oxideprobioticNissleCRISPRi
Input
Nitric oxide (NO)
Clinical / gut biomarker
→
Sense
CRISPRi-repression
dCas9 (S. pyogenes, catalytically dead)
→
Chassis
E. coli Nissle 1917
BSL-1
→
Output
sfGFP
fluorescent
What it detects
- Analyte
- Nitric oxide (NO) — NsrR responds to nM-µM NO
- Category
- Clinical / gut biomarker
- Signal
- Luminal nitric oxide produced by host iNOS during gut inflammation
Genetic circuit
⤢ click to enlarge
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
⤢ click to enlarge
CRISPR sensing mechanism
- Strategy
- CRISPRi-repression · NOT logic
- Cas protein
- dCas9 (S. pyogenes, catalytically dead)
- Analyte sensor
- NsrR is a [2Fe-2S] repressor that releases its operator (e.g. the hmp promoter) when NO modifies its cluster.
Signal flow
NO -> NsrR releases PnsrR/Phmp -> transcribes an anti-reporter sgRNA -> CRISPRi inverts a constitutive reporter (NOT). Pair an inverter or memory switch for a persistent inflammation record.Safe chassis
E. coli Nissle 1917 — Escherichia coli
A probiotic E. coli used in humans for over a century (Mutaflor). Colonizes the gut safely, making it the chassis of choice for clinical / gut biomarker biosensors.
BSL-1probiotic
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| NsrR regulator NO-responsive [2Fe-2S] repressor; endogenous to E. coli Nissle. | regulator | Native E. coli nsrR |
| Phmp / PnsrR promoter De-repressed when NO modifies NsrR. | promoter | E. coli NsrR-regulated promoter |
| Anti-reporter sgRNA | sgRNA | designed against the reporter promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| dCas9 | dCas9 | Qi et al. 2013 (CRISPRi) |
| sfGFP reporter Recoverable from stool for non-invasive readout. | reporter | Pedelacq et al. 2006 |
Output & readout
- Type
- fluorescent
- Reporter
- sfGFP
- Readout
- Fluorescence (flow cytometry on recovered cells)
- Positive result
- Signal reflects luminal NO / inflammation.
Performance
- Limit of detection
- NsrR module: nM-µM NO (module-validated).
- Dynamic range
- Physiological inflamed-gut NO
- Response time
- ~180 min
- Device validated
- No — design template (parts validated individually)
NsrR NO-sensing and CRISPRi are validated separately; integrated device is a design template. Complements the thiosulfate/tetrathionate/peroxide inflammation sensors.
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- No
- Biocontainment
- Probiotic E. coli Nissle host; add thyA/dapA auxotrophy for gut-restricted containment.
- Field-deployable
- Lab / supervised use
Probiotic chassis with a human-safety record; research / supervised clinical use only.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Design anti-reporter sgRNA Target the reporter promoter; check Nissle off-targets. |
| 2 | assembly | Assemble units TU1: Phmp -> sgRNA (native NsrR). TU2: dCas9 + constitutive sfGFP. Low-copy vector. |
| 3 | transformation | Transform E. coli Nissle 1917 Select; add auxotrophic containment. |
| 4 | induction | Validate in vitro Confirm NO-donor response across a standard curve before any animal work. |
| 5 | readout | Recover and measure Recover cells from stool; quantify fluorescence. |
Source & parts
- Design
- Design template combining the native E. coli NsrR nitric-oxide sensor with a dCas9 CRISPRi circuit in E. coli Nissle
- Parts validated in
- Tucker et al. / Spiro / NsrR nitric-oxide sensing (E. coli)
- Qi et al. 2013, Cell (CRISPRi)
- License
- Parts per their original sources; design template CC BY 4.0