Nitrate sensor (NarL + CRISPRi)
Detects nitrate in water and food. The native E. coli NarX/NarL nitrate two-component system gates a CRISPRa circuit driving a fluorescent reporter, in safe E. coli K-12.
Chemical / metaboliteBSL-1 chassistemplatenitratechemicalwater-qualityfood-safetyCRISPRa
Input
Nitrate (NO3-)
Chemical / metabolite
→
Sense
CRISPRa-activation
dCas9-ω (CRISPRa activator)
→
Chassis
E. coli K-12 (MG1655)
BSL-1
→
Output
sfGFP
fluorescent
What it detects
- Analyte
- Nitrate (NO3-) — NarX/NarL responds across µM-mM nitrate
- Category
- Chemical / metabolite
- Signal
- Nitrate in drinking water, agricultural runoff, and cured foods
Genetic circuit
⤢ click to enlarge
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
⤢ click to enlarge
CRISPR sensing mechanism
- Strategy
- CRISPRa-activation · amplifier logic
- Cas protein
- dCas9-ω (CRISPRa activator)
- Analyte sensor
- The NarX sensor kinase phosphorylates NarL in response to nitrate; phospho-NarL activates the nitrate-responsive Pnar promoter.
Signal flow
NO3- -> NarX/NarL activates Pnar -> transcribes an sgRNA -> dCas9-activator amplifies a weak reporter promoter (CRISPRa) -> green fluorescence rises with nitrate.Safe chassis
E. coli K-12 (MG1655) — Escherichia coli
The non-pathogenic laboratory workhorse. K-12 strains have lost the ability to colonize the human gut and are the reference BSL-1 host for genetic engineering, with the deepest tooling of any bacterial chassis.
BSL-1
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| NarX/NarL two-component system Endogenous nitrate sensor; no porting needed in E. coli. | regulator | Native E. coli nar regulon |
| Pnar promoter (e.g. PnarG) Activated by phospho-NarL under nitrate. | promoter | E. coli narGHJI promoter |
| Reporter-activating sgRNA Transcribed from Pnar. | sgRNA | designed upstream of a weak reporter promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| dCas9-ω activator | dCas9 | Bikard et al. 2013 (CRISPRa) |
| sfGFP | reporter | Pedelacq et al. 2006 |
Output & readout
- Type
- fluorescent
- Reporter
- sfGFP
- Readout
- Green fluorescence (plate reader / field fluorimeter)
- Positive result
- Fluorescence increases with nitrate concentration.
Performance
- Limit of detection
- NarX/NarL module reports nitrate over µM-mM (module-validated).
- Dynamic range
- ~10 µM - 10 mM nitrate
- Response time
- ~120 min
- Device validated
- No — design template (parts validated individually)
Uses E. coli's native nitrate sensor (anaerobic/microaerobic induction); CRISPRa amplifier integration is a design template. Note Pnar is also FNR/oxygen-modulated.
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- No
- Biocontainment
- Lab/contained; add kill-switch for field use.
- Field-deployable
- Yes (with containment)
E. coli K-12 non-pathogenic BSL-1 host; relevant to drinking-water and food-safety nitrate limits.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Design CRISPRa sgRNA Target the activation window of a weak reporter promoter; verify host off-targets. |
| 2 | assembly | Assemble units TU1: Pnar -> sgRNA (NarX/NarL endogenous). TU2: dCas9-omega. TU3: weak promoter -> sfGFP. |
| 3 | transformation | Transform E. coli K-12 Select; confirm nitrate-dependent activation and low background. |
| 4 | induction | Expose to sample Incubate (micro-aerobically) with the sample + nitrate standard curve. |
| 5 | readout | Measure fluorescence Interpolate nitrate from the curve. |
Source & parts
- Design
- Design template combining E. coli's native NarX/NarL nitrate sensor with a dCas9 CRISPRa reporter
- Parts validated in
- Stewart 1993 / E. coli nar regulon literature (NarX/NarL nitrate sensing)
- Bikard et al. 2013, NAR (CRISPRa)
- License
- Parts per their original sources; design template CC BY 4.0