Nickel/cobalt sensor (RcnR + CRISPRi)
Detects nickel and cobalt in water. The native E. coli RcnR metal-responsive repressor gates a CRISPRi circuit driving a visible chromoprotein, in safe E. coli K-12.
Environmental contaminantBSL-1 chassistemplatenickelcobaltheavy-metalwaterenvironmentalCRISPRichromoprotein
Input
Nickel Ni(II) / Cobalt Co(II)
Environmental contaminant
→
Sense
CRISPRi-repression
dCas9 (S. pyogenes, catalytically dead)
→
Chassis
E. coli K-12 (MG1655)
BSL-1
→
Output
amilCP
pigment
What it detects
- Analyte
- Nickel Ni(II) / Cobalt Co(II) — RcnR responds from sub-µM Ni(II)/Co(II)
- Category
- Environmental contaminant
- Signal
- Bioavailable nickel and cobalt in water
Genetic circuit
⤢ click to enlarge
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
⤢ click to enlarge
CRISPR sensing mechanism
- Strategy
- CRISPRi-repression · NOT logic
- Cas protein
- dCas9 (S. pyogenes, catalytically dead)
- Analyte sensor
- RcnR represses the rcnAB efflux promoter (PrcnA) and is released when it binds Ni(II)/Co(II).
Signal flow
Ni/Co -> RcnR releases PrcnA -> transcribes an anti-pigment sgRNA -> dCas9 + sgRNA repress a constitutive amilCP cassette (CRISPRi) -> pigment fades with metal (NOT). Pair an inverter for colour-on.Safe chassis
E. coli K-12 (MG1655) — Escherichia coli
The non-pathogenic laboratory workhorse. K-12 strains have lost the ability to colonize the human gut and are the reference BSL-1 host for genetic engineering, with the deepest tooling of any bacterial chassis.
BSL-1
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| RcnR regulator Ni(II)/Co(II)-responsive repressor; endogenous to E. coli. | regulator | Native E. coli rcnR |
| PrcnA promoter De-repressed by metal-bound RcnR. | promoter | E. coli rcnAB promoter |
| Anti-pigment sgRNA | sgRNA | designed against the amilCP promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| dCas9 | dCas9 | Qi et al. 2013 (CRISPRi) |
| amilCP chromoprotein Naked-eye pigment. | reporter | BBa_K592009 |
Output & readout
- Type
- pigment
- Reporter
- amilCP
- Readout
- Visible pigment (naked eye / smartphone)
- Positive result
- Pigment change reports nickel/cobalt concentration.
Performance
- Limit of detection
- RcnR module: sub-µM Ni(II)/Co(II) (module-validated).
- Dynamic range
- ~0.1-10 µM
- Response time
- ~180 min
- Device validated
- No — design template (parts validated individually)
RcnR senses both nickel and cobalt; integrated CRISPRi device is a design template.
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- No
- Biocontainment
- Lab/contained; add kill-switch for field use.
- Field-deployable
- Yes (with containment)
E. coli K-12 non-pathogenic BSL-1 host; instrument-free pigment readout.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Design anti-pigment sgRNA Target the amilCP promoter; check host off-targets. |
| 2 | assembly | Assemble units TU1: PrcnA -> sgRNA (native RcnR). TU2: dCas9 + constitutive amilCP. |
| 3 | transformation | Transform E. coli K-12 Select; confirm baseline pigment without metal. |
| 4 | induction | Expose to sample Add water sample + Ni/Co standard curve. |
| 5 | readout | Score colour Compare pigment to the curve. |
Source & parts
- Design
- Design template combining the native E. coli RcnR nickel/cobalt sensor with CRISPRi
- Parts validated in
- Iwig et al. 2006 / RcnR nickel-cobalt sensing (E. coli)
- Qi et al. 2013, Cell (CRISPRi)
- License
- Parts per their original sources; design template CC BY 4.0