Mercury soil/water sensor (MerR + CRISPRi)
Detects ionic mercury Hg(II) in soil and water. The MerR/PmerT sensing module gates a CRISPRi circuit driving a visible chromoprotein, in the rugged environmental chassis P. putida KT2440.
Environmental contaminantBSL-1 chassistemplatemercuryheavy-metalsoilwaterenvironmentalCRISPRichromoprotein
Input
Mercuric ion Hg(II)
Environmental contaminant
→
Sense
CRISPRa-activation
dCas9-ω (CRISPRa activator)
→
Chassis
Pseudomonas putida KT2440
BSL-1
→
Output
amilCP
pigment
What it detects
- Analyte
- Mercuric ion Hg(II) — MerR-based sensors respond from sub-µM to µM Hg(II)
- Category
- Environmental contaminant
- Signal
- Bioavailable inorganic mercury in soil/water
Genetic circuit
⤢ click to enlarge
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
⤢ click to enlarge
CRISPR sensing mechanism
- Strategy
- CRISPRa-activation · amplifier logic
- Cas protein
- dCas9-ω (CRISPRa activator)
- Analyte sensor
- MerR binds Hg(II) and switches the PmerT promoter from repressed to activated (a distorted-operator activation mechanism).
Signal flow
Hg(II) -> MerR activates PmerT -> PmerT transcribes an sgRNA -> sgRNA + dCas9-activator recruit RNA polymerase to a weak reporter promoter (CRISPRa) -> amilCP chromoprotein is produced -> visible blue-purple colour (BUFFER/amplifier).Safe chassis
Pseudomonas putida KT2440 — Pseudomonas putida
A certified safety-strain soil bacterium with exceptional solvent/stress tolerance and diverse metabolism. The premier chassis for environmental biosensing of pollutants and heavy metals in soil and water.
BSL-1
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| MerR regulator Hg(II)-responsive activator/repressor (MerR family). | regulator | Tn21/Tn501 mer operon |
| PmerT promoter Activated by Hg(II)-bound MerR. | promoter | mer operon operator/promoter |
| Reporter-targeting sgRNA Transcribed from PmerT. | sgRNA | designed to target the weak reporter promoter for CRISPRa |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| dCas9-ω activator dCas9 fused to RNAP omega subunit for transcriptional activation. | dCas9 | Bikard et al. 2013; Dong et al. 2018 (CRISPRa) |
| amilCP chromoprotein Blue-purple pigment, visible to the naked eye (no instrument). | reporter | BBa_K592009 |
Output & readout
- Type
- pigment
- Reporter
- amilCP
- Readout
- Visible blue-purple pigment (naked eye / smartphone camera)
- Positive result
- Cells/colonies turn blue-purple when mercury is present.
Performance
- Limit of detection
- MerR sensing module: sub-µM Hg(II) (module-validated).
- Dynamic range
- ~0.1-10 µM Hg(II) for native MerR modules
- Response time
- ~180 min
- Device validated
- No — design template (parts validated individually)
MerR mercury sensors and CRISPRa are validated separately in the literature; the integrated CRISPRa device is a design template.
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- No
- Biocontainment
- P. putida KT2440 is a certified HV1 safety host; pair with a containment circuit for field use.
- Field-deployable
- Yes (with containment)
Pigment output needs no instrument, suited to low-resource field testing.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Design the CRISPRa sgRNA Target a window upstream of a weak reporter promoter for activation; verify host off-targets. |
| 2 | assembly | Assemble units TU1: MerR + PmerT -> sgRNA. TU2: dCas9-omega. TU3: weak promoter -> amilCP. Clone into SEVA vectors for P. putida. |
| 3 | transformation | Transform P. putida KT2440 Electroporate and select; confirm low background pigment without mercury. |
| 4 | induction | Expose to sample Incubate with the soil eluate / water sample plus a Hg(II) standard curve. |
| 5 | readout | Score colour Compare pigment to the standard curve by eye or camera. |
Source & parts
- Design
- Design template combining a validated MerR/PmerT mercury-sensing module with a dCas9 CRISPRa reporter circuit
- Parts validated in
- mer operon / MerR mercury biosensors (e.g. Selifonova et al. 1993)
- Bikard et al. 2013, NAR (dCas9 activation)
- iGEM Uppsala amilCP (BBa_K592009)
- License
- Parts per their original sources; design template CC BY 4.0