Manganese sensor (MntR + CRISPRi)
Detects manganese in water and soil. The native B. subtilis MntR manganese-responsive regulator gates a CRISPRi circuit driving a fluorescent reporter, in spore-forming Bacillus subtilis 168.
Environmental contaminantBSL-1 chassisGRAStemplatemanganesemetalwatersoilenvironmentalCRISPRispore
Input
Manganese Mn(II)
Environmental contaminant
→
Sense
CRISPRi-repression
dCas9 (S. pyogenes, catalytically dead)
→
Chassis
Bacillus subtilis 168
BSL-1
→
Output
sfGFP
fluorescent
What it detects
- Analyte
- Manganese Mn(II) — MntR responds across µM Mn(II)
- Category
- Environmental contaminant
- Signal
- Bioavailable manganese in water and soil
Genetic circuit
⤢ click to enlarge
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
⤢ click to enlarge
CRISPR sensing mechanism
- Strategy
- CRISPRi-repression · NOT logic
- Cas protein
- dCas9 (S. pyogenes, catalytically dead)
- Analyte sensor
- MntR binds Mn(II) and represses manganese-uptake promoters (and activates efflux); metal occupancy switches its target promoter.
Signal flow
Mn(II) -> MntR switches its target promoter -> transcribes an anti-reporter sgRNA -> CRISPRi inverts a constitutive reporter (NOT). Pair an inverter for turn-on.Safe chassis
Bacillus subtilis 168 — Bacillus subtilis
Gram-positive, spore-forming model bacterium with QPS (EFSA) status and a long history of safe industrial use. Spores make it robust for field-deployable and environmental biosensors.
BSL-1GRAS · EFSA Qualified Presumption of Safety (QPS)
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| MntR regulator Mn(II)-responsive metalloregulator; endogenous to B. subtilis. | regulator | Native B. subtilis mntR |
| MntR target promoter (e.g. PmntABCD) Switched by Mn-bound MntR. | promoter | B. subtilis mnt uptake promoter |
| Anti-reporter sgRNA | sgRNA | designed against the reporter promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| dCas9 | dCas9 | Peters et al. 2016 (CRISPRi in B. subtilis) |
| Pveg promoter Drives sfGFP (CRISPRi target). | promoter | B. subtilis vegetative promoter |
| sfGFP | reporter | Pedelacq et al. 2006 |
Output & readout
- Type
- fluorescent
- Reporter
- sfGFP
- Readout
- Green fluorescence (field fluorimeter)
- Positive result
- Fluorescence change reports manganese.
Performance
- Limit of detection
- MntR module: µM Mn(II) (module-validated).
- Dynamic range
- ~1-100 µM Mn(II)
- Response time
- ~150 min
- Device validated
- No — design template (parts validated individually)
MntR manganese sensing and B. subtilis CRISPRi are validated separately; integrated device is a design template. Spores allow ambient storage.
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- Yes
- Biocontainment
- GRAS, spore-forming host; auxotrophic/spore containment.
- Field-deployable
- Yes (with containment)
Spores allow ambient storage and field reconstitution.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Design anti-reporter sgRNA Target the sfGFP promoter; check B. subtilis off-targets. |
| 2 | assembly | Assemble units TU1: MntR target promoter -> sgRNA (native MntR). TU2: dCas9 + Pveg -> sfGFP. Integrate at amyE. |
| 3 | transformation | Transform B. subtilis 168 Natural competence; select; confirm low background. |
| 4 | induction | Expose to sample Reconstitute spores; add sample + manganese standard curve. |
| 5 | readout | Measure fluorescence Interpolate Mn(II) from the curve. |
Source & parts
- Design
- Design template combining the native B. subtilis MntR manganese sensor with CRISPRi
- Parts validated in
- Que & Helmann / MntR manganese regulation (B. subtilis)
- Peters et al. 2016, Cell (CRISPRi in B. subtilis)
- License
- Parts per their original sources; design template CC BY 4.0