Lysine sensor (LysG + CRISPRa)
Detects L-lysine — the flagship amino-acid product of C. glutamicum. The native LysG transcriptional sensor (used in the classic pSenLys biosensor) gates a CRISPRa circuit driving a fluorescent reporter, for strain screening and process monitoring.
What it detects
- Analyte
- L-lysine — LysG sensor responds across mM lysine
- Category
- Chemical / metabolite
- Signal
- Intracellular/extracellular L-lysine (and basic amino acids) for strain screening and fermentation monitoring
Genetic circuit
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
CRISPR sensing mechanism
- Strategy
- CRISPRa-activation · amplifier logic
- Cas protein
- dCas9-ω (CRISPRa activator)
- Analyte sensor
- LysG (LysR-family) activates the lysE promoter in response to L-lysine (and arginine/histidine).
Safe chassis
A GRAS industrial workhorse used for food-grade amino-acid production at megaton scale. Robust, stress-tolerant, and easy to grow at high density — well suited to industrial-process and chemical monitoring.
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| LysG regulator | regulator | Native C. glutamicum lysG (LysR family); Binder et al. 2012 (pSenLys) |
| PlysE promoter | promoter | C. glutamicum lysE promoter |
| sgRNA | sgRNA | designed against / upstream of the reporter promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| dCas9-ω activator | dCas9 | Cleto et al. 2016 (CRISPRi/a in C. glutamicum) |
| eYFP | reporter | fluorophore for FACS screening |
Output & readout
- Type
- fluorescent
- Reporter
- eYFP
- Readout
- Fluorescence (plate reader / FACS)
- Positive result
- Fluorescence scales with lysine — enabling single-cell producer screening.
Performance
- Device validated
- No — design template (parts validated individually)
The LysG/lysE amino-acid biosensor (pSenLys) is validated for FACS-based strain screening; the CRISPRa-amplified version is a design template. Also responds to arginine/histidine.
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- Yes
- Biocontainment
- Auxotrophic containment; GRAS industrial host.
- Field-deployable
- Lab / supervised use
GRAS industrial host; bioprocess/QC application.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Design sgRNA Target/position the sgRNA; check C. glutamicum off-targets. |
| 2 | assembly | Assemble units Sensor -> sgRNA; dCas9; reporter. Use the host's standard toolkit. |
| 3 | transformation | Transform C. glutamicum Transform, select, and confirm low background. |
| 4 | induction | Expose to sample Incubate with the sample plus a lysine standard curve. |
| 5 | readout | Read result Relate signal to concentration. |
Source & parts
- Design
- Design template combining the LysG/lysE lysine biosensor with C. glutamicum CRISPRa
- Parts validated in
- Binder et al. 2012, Genome Biol (LysG/pSenLys amino-acid biosensor)
- Cleto et al. 2016 (CRISPRi in C. glutamicum)
- License
- Parts per their original sources; design template CC BY 4.0