Lead water sensor (PbrR + CRISPRi)
Detects lead Pb(II) in water. The PbrR metal-responsive regulator gates a CRISPRi circuit driving sfGFP, in spore-forming Bacillus subtilis 168 for rugged, field-storable testing.
Environmental contaminantBSL-1 chassisGRAStemplateleadheavy-metalwaterenvironmentalCRISPRisporefield
Input
Lead Pb(II)
Environmental contaminant
→
Sense
CRISPRi-repression
dCas9 (S. pyogenes, catalytically dead)
→
Chassis
Bacillus subtilis 168
BSL-1
→
Output
sfGFP
fluorescent
What it detects
- Analyte
- Lead Pb(II) — PbrR sensors respond from sub-µM to µM Pb(II); aim below the 10 µg/L (~0.05 µM) WHO/EPA action level
- Category
- Environmental contaminant
- Signal
- Bioavailable inorganic lead in drinking water
Genetic circuit
⤢ click to enlarge
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
⤢ click to enlarge
CRISPR sensing mechanism
- Strategy
- CRISPRi-repression · NOT logic
- Cas protein
- dCas9 (S. pyogenes, catalytically dead)
- Analyte sensor
- PbrR (a MerR-family regulator) binds Pb(II) and activates the pbr promoter.
Signal flow
Pb(II) -> PbrR activates Ppbr -> transcribes an anti-reporter sgRNA -> dCas9 + sgRNA repress a constitutive sfGFP cassette (CRISPRi) -> fluorescence inverts with lead. Pair a second inverter for turn-on output.Safe chassis
Bacillus subtilis 168 — Bacillus subtilis
Gram-positive, spore-forming model bacterium with QPS (EFSA) status and a long history of safe industrial use. Spores make it robust for field-deployable and environmental biosensors.
BSL-1GRAS · EFSA Qualified Presumption of Safety (QPS)
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| PbrR regulator Lead-responsive MerR-family activator; may require codon-optimisation for B. subtilis. | regulator | Cupriavidus metallidurans pbr operon |
| Ppbr promoter Activated by Pb(II)-bound PbrR. | promoter | C. metallidurans pbr operator/promoter |
| Anti-reporter sgRNA Transcribed from Ppbr. | sgRNA | designed against the sfGFP promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| dCas9 CRISPRi is validated in B. subtilis. | dCas9 | Peters et al. 2016 (CRISPRi in B. subtilis) |
| Pveg promoter Drives the sfGFP reporter (CRISPRi target). | promoter | B. subtilis vegetative promoter |
| sfGFP | reporter | Pedelacq et al. 2006 |
Output & readout
- Type
- fluorescent
- Reporter
- sfGFP
- Readout
- Green fluorescence (field fluorimeter)
- Positive result
- Fluorescence change scales with lead concentration.
Performance
- Limit of detection
- PbrR module: sub-µM Pb(II) (module-validated).
- Dynamic range
- ~0.05-5 µM Pb(II)
- Response time
- ~150 min
- Device validated
- No — design template (parts validated individually)
PbrR lead sensors and B. subtilis CRISPRi are validated separately; integrated device is a design template. Spores allow ambient-temperature storage and reconstitution in the field.
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- Yes
- Biocontainment
- B. subtilis is contained via auxotrophy/spore control; GRAS host.
- Field-deployable
- Yes (with containment)
GRAS, spore-forming chassis well suited to low-resource field deployment.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Design anti-reporter sgRNA Target the sfGFP promoter; check B. subtilis off-targets. |
| 2 | assembly | Assemble units TU1: PbrR. TU2: Ppbr -> sgRNA. TU3: dCas9 + Pveg -> sfGFP. Integrate at amyE/thrC loci. |
| 3 | transformation | Transform B. subtilis 168 Use natural competence; select integrants; confirm low background. |
| 4 | induction | Expose to sample Reconstitute spores, add water sample + lead standard curve. |
| 5 | readout | Measure fluorescence Interpolate Pb(II) from the standard curve. |
Source & parts
- Design
- Design template combining a PbrR lead-sensing module with B. subtilis CRISPRi
- Parts validated in
- Borremans et al. 2001 (pbr lead resistance/sensing, C. metallidurans)
- Peters et al. 2016, Cell (CRISPRi in B. subtilis)
- License
- Parts per their original sources; design template CC BY 4.0