Iron sensor (Fur + CRISPRi)
Reports bioavailable iron via the Fur ferric-uptake regulator, gating a CRISPRi circuit driving a fluorescent reporter, in the robust environmental chassis P. putida KT2440. Useful for soil/water iron and process monitoring.
Chemical / metaboliteBSL-1 chassistemplateironmicronutrientsoilwaterchemicalCRISPRi
Input
Ferric/ferrous iron (Fe)
Chemical / metabolite
→
Sense
CRISPRi-repression
dCas9 (S. pyogenes, catalytically dead)
→
Chassis
Pseudomonas putida KT2440
BSL-1
→
Output
sfGFP
fluorescent
What it detects
- Analyte
- Ferric/ferrous iron (Fe) — Fur-regulated promoters report iron status across physiological ranges
- Category
- Chemical / metabolite
- Signal
- Bioavailable iron in soil, water, or process samples
Genetic circuit
⤢ click to enlarge
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
⤢ click to enlarge
CRISPR sensing mechanism
- Strategy
- CRISPRi-repression · NOT logic
- Cas protein
- dCas9 (S. pyogenes, catalytically dead)
- Analyte sensor
- Fur (ferric uptake regulator) binds Fe(II) and represses iron-uptake (Fur-box) promoters; under low iron it releases them.
Signal flow
Low iron -> Fur releases a Fur-box promoter -> transcribes an sgRNA -> CRISPRi represses a constitutive reporter (signal reports iron limitation). Invert as needed so high iron reads as reporter-on.Safe chassis
Pseudomonas putida KT2440 — Pseudomonas putida
A certified safety-strain soil bacterium with exceptional solvent/stress tolerance and diverse metabolism. The premier chassis for environmental biosensing of pollutants and heavy metals in soil and water.
BSL-1
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| Fur regulator Iron-responsive master regulator. | regulator | Conserved ferric uptake regulator (native to P. putida) |
| Fur-box promoter (e.g. PfecA/PfepA) Repressed by Fe-bound Fur. | promoter | iron-uptake gene promoter with a Fur box |
| Reporter-targeting sgRNA | sgRNA | designed against the reporter promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| dCas9 | dCas9 | CRISPRi (established in P. putida) |
| sfGFP | reporter | Pedelacq et al. 2006 |
Output & readout
- Type
- fluorescent
- Reporter
- sfGFP
- Readout
- Green fluorescence (plate reader / field fluorimeter)
- Positive result
- Fluorescence reflects iron availability.
Performance
- Limit of detection
- Fur-regulated promoters report iron status (module-validated).
- Dynamic range
- Physiological iron range
- Response time
- ~150 min
- Device validated
- No — design template (parts validated individually)
Fur is a global regulator, so context affects output; integrated CRISPRi device is a design template. Best used as a relative iron-status reporter.
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- No
- Biocontainment
- P. putida KT2440 certified HV1 safety host; add containment for field use.
- Field-deployable
- Yes (with containment)
Robust soil/water chassis.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Design sgRNA Target the reporter promoter; check host off-targets. |
| 2 | assembly | Assemble units TU1: Fur-box promoter -> sgRNA (native Fur). TU2: dCas9 + constitutive sfGFP. Clone into SEVA vectors. |
| 3 | transformation | Transform P. putida KT2440 Electroporate; select; calibrate against iron-replete/limited media. |
| 4 | induction | Expose to sample Add sample + iron standard curve. |
| 5 | readout | Measure fluorescence Interpolate relative iron from the curve. |
Source & parts
- Design
- Design template combining the Fur iron-sensing module with P. putida CRISPRi
- Parts validated in
- Bagg & Neilands 1987 / Fur ferric uptake regulation
- CRISPRi literature (dCas9)
- License
- Parts per their original sources; design template CC BY 4.0