Gut inflammation memory recorder (tetrathionate)
Records a transient gut-inflammation episode and remembers it. A recombinase memory switch, triggered by the tetrathionate sensor, flips a DNA state that persists after the signal is gone — so a single exposure is still detectable days later in stool.
What it detects
memory design — records a transient exposure and remembers it.
- Analyte
- Tetrathionate (transient) — Records exposure above the sensor's threshold
- Category
- Clinical / gut biomarker
- Signal
- A transient tetrathionate / inflammation episode that may not coincide with sampling
Genetic circuit
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
CRISPR sensing mechanism
- Strategy
- CRISPRi-repression · BUFFER logic
- Cas protein
- dCas9 (S. pyogenes, catalytically dead)
- Analyte sensor
- The TtrS/TtrR tetrathionate sensor drives a recombinase (integrase) that flips a DNA register; the flipped state is heritable and stable without further signal.
Safe chassis
A probiotic E. coli used in humans for over a century (Mutaflor). Colonizes the gut safely, making it the chassis of choice for clinical / gut biomarker biosensors.
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| TtrS/TtrR sensor Validated in vivo; triggers the recombinase. | regulator | Daeffler/Riglar et al. (tetrathionate sensor in Nissle) |
| Recombinase / integrase (e.g. Bxb1) Flips a DNA register to store the memory bit. | cds | phage serine integrase |
| Flippable DNA register Heritable two-state memory element. | operator | attB/attP-flanked invertible segment |
| dCas9 Optional gating/reset of the register. | dCas9 | Qi et al. 2013 (CRISPRi) |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| sfGFP reporter Switched permanently ON by the flipped register; recoverable from stool. | reporter | Pedelacq et al. 2006 |
Output & readout
- Type
- fluorescent
- Reporter
- sfGFP
- Readout
- Fluorescence (flow cytometry on recovered cells)
- Positive result
- Cells stay fluorescent after a past inflammation episode, even once tetrathionate is gone.
Performance
- Device validated
- No — design template (parts validated individually)
Recombinase memory + the tetrathionate sensor are each validated in vivo (Riglar et al. 2017); this CRISPRi-gated memory variant is a design template. Captures intermittent inflammation that real-time sensors miss.
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- No
- Biocontainment
- Probiotic E. coli Nissle host; add thyA/dapA auxotrophy for gut-restricted containment.
- Field-deployable
- Lab / supervised use
Probiotic chassis with a human-safety record; research / supervised clinical use only.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Design the memory register Place a recombinase-invertible register controlling the reporter; design any CRISPRi reset. |
| 2 | assembly | Assemble units TU1: TtrS/TtrR -> recombinase. TU2: invertible register -> reporter. Optional dCas9 reset arm. |
| 3 | transformation | Transform E. coli Nissle 1917 Select; verify the register flips on tetrathionate and stays flipped. |
| 4 | induction | Pulse exposure Apply a transient tetrathionate pulse, then remove it; confirm the memory persists. |
| 5 | readout | Recover and read state Recover cells (e.g. from stool) and read the flipped fraction. |
Source & parts
- Design
- Design template: a recombinase memory recorder triggered by the validated tetrathionate sensor, with optional CRISPRi gating
- Parts validated in
- Riglar et al. 2017, Nat. Biotechnol. (in-vivo memory sensor)
- Bxb1 / serine integrase memory devices
- Qi et al. 2013, Cell (CRISPRi)
- License
- Parts per their original sources; design template CC BY 4.0