GI bleeding sensor (heme + CRISPRa)
An ingestible sensor for heme, a marker of gastrointestinal bleeding. The validated HrtR heme sensor gates a CRISPRa circuit driving a luminescent reporter, in the probiotic E. coli Nissle 1917.
Clinical / gut biomarkerBSL-1 chassistemplateclinical-gutGI-bleedinghemebloodprobioticNissleCRISPRaluminescent
Input
Heme
Clinical / gut biomarker
→
Sense
CRISPRa-activation
dCas9-ω (CRISPRa activator)
→
Chassis
E. coli Nissle 1917
BSL-1
→
Output
luxCDABE
luminescent
What it detects
- Analyte
- Heme — HrtR-based heme sensors respond over physiological luminal heme
- Category
- Clinical / gut biomarker
- Signal
- Heme released into the gut lumen during gastrointestinal bleeding
Genetic circuit
⤢ click to enlarge
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
⤢ click to enlarge
CRISPR sensing mechanism
- Strategy
- CRISPRa-activation · amplifier logic
- Cas protein
- dCas9-ω (CRISPRa activator)
- Analyte sensor
- HrtR is a heme-binding repressor; heme binding releases it from the PhrtBA operator, de-repressing the promoter (which is then boosted by CRISPRa).
Signal flow
Heme -> HrtR releases PhrtBA -> transcribes an sgRNA -> dCas9-activator amplifies a luminescent reporter (CRISPRa) -> luminescence reports gut bleeding.Safe chassis
E. coli Nissle 1917 — Escherichia coli
A probiotic E. coli used in humans for over a century (Mutaflor). Colonizes the gut safely, making it the chassis of choice for clinical / gut biomarker biosensors.
BSL-1probiotic
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| HrtR repressor Heme-responsive repressor; validated as an ingestible heme sensor in vivo (pig/large-animal). | regulator | Lactococcus lactis hrt system; used as a heme sensor by Mimee et al. 2018 |
| PhrtBA promoter De-repressed by heme-bound HrtR. | promoter | hrtBA operator/promoter |
| Reporter-activating sgRNA | sgRNA | designed for CRISPRa upstream of a weak luminescent reporter promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| dCas9-ω activator | dCas9 | Bikard et al. 2013 (CRISPRa) |
| luxCDABE operon Luminescent output, pairs with an ingestible photodetector (cf. Mimee et al. 2018). | reporter | bacterial bioluminescence operon |
Output & readout
- Type
- luminescent
- Reporter
- luxCDABE
- Readout
- Bioluminescence (photodetector; in vivo, an ingestible bio-electronic capsule)
- Positive result
- Luminescence rises when luminal heme (bleeding) is present.
Performance
- Limit of detection
- HrtR heme module validated in vivo as an ingestible sensor (Mimee et al. 2018).
- Dynamic range
- Physiological luminal heme range
- Response time
- ~120 min
- Device validated
- No — design template (parts validated individually)
The HrtR heme sensor with luminescent output is validated in vivo (bio-electronic pill); the CRISPRa amplifier integration here is a design template to boost sensitivity.
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- No
- Biocontainment
- Probiotic E. coli Nissle host; pair with auxotrophy for gut-restricted containment.
- Field-deployable
- Lab / supervised use
Research / supervised clinical use only; probiotic chassis with a human-safety record.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Design CRISPRa sgRNA Target the activation window of the weak luminescent reporter promoter. |
| 2 | assembly | Assemble units TU1: HrtR. TU2: PhrtBA -> sgRNA. TU3: dCas9-omega. TU4: weak promoter -> luxCDABE. |
| 3 | transformation | Transform E. coli Nissle 1917 Select; add containment marker. |
| 4 | induction | Validate with heme Confirm heme-dependent luminescence across a standard curve. |
| 5 | readout | Detect luminescence Read with a photodetector / ingestible capsule. |
Source & parts
- Design
- Design template combining the validated HrtR heme sensor with a dCas9 CRISPRa luminescent circuit in E. coli Nissle
- Parts validated in
- Mimee et al. 2018, Science (ingestible heme bio-electronic sensor; HrtR)
- Bikard et al. 2013, NAR (CRISPRa)
- License
- Parts per their original sources; design template CC BY 4.0