Gut inflammation sensor (thiosulfate + CRISPRi)
An ingestible sensor for gut inflammation. The validated thiosulfate two-component sensor (ThsSR) gates a CRISPRi amplifier driving a fluorescent reporter, in the human probiotic E. coli Nissle 1917.
Clinical / gut biomarkerBSL-1 chassistemplateclinical-gutinflammationthiosulfateprobioticNissleCRISPRi
Input
Thiosulfate (S2O3 2-)
Clinical / gut biomarker
→
Sense
CRISPRa-activation
dCas9-ω (CRISPRa activator)
→
Chassis
E. coli Nissle 1917
BSL-1
→
Output
sfGFP
fluorescent
What it detects
- Analyte
- Thiosulfate (S2O3 2-) — ThsSR sensor responds over physiological gut thiosulfate ranges (validated in mouse colitis models)
- Category
- Clinical / gut biomarker
- Signal
- Thiosulfate, a biomarker elevated during gut inflammation
Genetic circuit
⤢ click to enlarge
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
⤢ click to enlarge
CRISPR sensing mechanism
- Strategy
- CRISPRa-activation · amplifier logic
- Cas protein
- dCas9-ω (CRISPRa activator)
- Analyte sensor
- The ThsS membrane histidine kinase autophosphorylates in response to thiosulfate and activates the response regulator ThsR, which turns on its target promoter.
Signal flow
Thiosulfate -> ThsS/ThsR two-component system activates PthsR -> transcribes an sgRNA -> dCas9-activator amplifies a fluorescent reporter (CRISPRa) -> green fluorescence reports gut inflammation.Safe chassis
E. coli Nissle 1917 — Escherichia coli
A probiotic E. coli used in humans for over a century (Mutaflor). Colonizes the gut safely, making it the chassis of choice for clinical / gut biomarker biosensors.
BSL-1probiotic
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| ThsS/ThsR two-component system Thiosulfate-sensing histidine kinase + response regulator; validated in E. coli Nissle in vivo. | regulator | Shewanella; ported to E. coli by Daeffler et al. 2017, Mol. Syst. Biol. |
| PthsR (ThsR target promoter) Activated by phosphorylated ThsR. | promoter | Daeffler et al. 2017 |
| Reporter-activating sgRNA Transcribed from PthsR. | sgRNA | designed for CRISPRa upstream of a weak reporter promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| dCas9-ω activator | dCas9 | CRISPRa (Bikard et al. 2013; Dong et al. 2018) |
| sfGFP / mCherry reporter Fluorescent readout recoverable from stool for non-invasive monitoring. | reporter | standard fluorophores |
Output & readout
- Type
- fluorescent
- Reporter
- sfGFP
- Readout
- Fluorescence (flow cytometry / plate reader on recovered cells)
- Positive result
- Fluorescent-cell fraction rises with gut thiosulfate (inflammation).
Performance
- Limit of detection
- ThsSR module validated to report thiosulfate in mouse gut (Daeffler et al. 2017).
- Dynamic range
- Physiological gut thiosulfate range
- Response time
- ~240 min
- Device validated
- No — design template (parts validated individually)
The thiosulfate sensor in E. coli Nissle is validated in vivo; the CRISPRa amplifier integration is a design template intended to boost the in-vivo signal.
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- No
- Biocontainment
- Built in the probiotic E. coli Nissle 1917; pair with thyA/dapA auxotrophy for gut-restricted containment before any in-vivo use.
- Field-deployable
- Lab / supervised use
Probiotic chassis with a long human-safety record; intended for research / supervised clinical study only.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Design CRISPRa sgRNA Target the activation window of a weak reporter promoter; verify Nissle off-targets. |
| 2 | assembly | Assemble units TU1: ThsS/ThsR. TU2: PthsR -> sgRNA. TU3: dCas9-omega. TU4: weak promoter -> sfGFP. Integrate or use a stable low-copy vector. |
| 3 | transformation | Transform E. coli Nissle 1917 Select; add an auxotrophic containment marker. |
| 4 | induction | Expose to thiosulfate Validate in vitro across a thiosulfate curve before any animal work. |
| 5 | readout | Recover and measure Recover cells (e.g. from stool) and quantify fluorescence. |
Source & parts
- Design
- Design template combining the validated ThsSR thiosulfate sensor in E. coli Nissle with a dCas9 CRISPRa amplifier
- Parts validated in
- Daeffler et al. 2017, Mol. Syst. Biol. (thiosulfate sensor in E. coli Nissle)
- Riglar et al. 2017, Nat. Biotechnol. (engineered Nissle gut sensors)
- Bikard et al. 2013, NAR (CRISPRa)
- License
- Parts per their original sources; design template CC BY 4.0