Gut inflammation sensor (thiosulfate + CRISPRi)

An ingestible sensor for gut inflammation. The validated thiosulfate two-component sensor (ThsSR) gates a CRISPRi amplifier driving a fluorescent reporter, in the human probiotic E. coli Nissle 1917.

Clinical / gut biomarkerBSL-1 chassistemplateclinical-gutinflammationthiosulfateprobioticNissleCRISPRi
Input
Thiosulfate (S2O3 2-)
Clinical / gut biomarker
Sense
CRISPRa-activation
dCas9-ω (CRISPRa activator)
Chassis
E. coli Nissle 1917
BSL-1
Output
sfGFP
fluorescent

What it detects

Analyte
Thiosulfate (S2O3 2-) — ThsSR sensor responds over physiological gut thiosulfate ranges (validated in mouse colitis models)
Category
Clinical / gut biomarker
Signal
Thiosulfate, a biomarker elevated during gut inflammation

Genetic circuit

⤢ click to enlarge

Genetic construct (SBOL)

The DNA construct as transcription units, drawn with SBOL Visual part glyphs.

⤢ click to enlarge

CRISPR sensing mechanism

Strategy
CRISPRa-activation · amplifier logic
Cas protein
dCas9-ω (CRISPRa activator)
Analyte sensor
The ThsS membrane histidine kinase autophosphorylates in response to thiosulfate and activates the response regulator ThsR, which turns on its target promoter.
Signal flow
Thiosulfate -> ThsS/ThsR two-component system activates PthsR -> transcribes an sgRNA -> dCas9-activator amplifies a fluorescent reporter (CRISPRa) -> green fluorescence reports gut inflammation.

Safe chassis

E. coli Nissle 1917Escherichia coli

A probiotic E. coli used in humans for over a century (Mutaflor). Colonizes the gut safely, making it the chassis of choice for clinical / gut biomarker biosensors.

BSL-1probiotic

Genetic parts

PartRoleSource / id
ThsS/ThsR two-component system
Thiosulfate-sensing histidine kinase + response regulator; validated in E. coli Nissle in vivo.
regulatorShewanella; ported to E. coli by Daeffler et al. 2017, Mol. Syst. Biol.
PthsR (ThsR target promoter)
Activated by phosphorylated ThsR.
promoterDaeffler et al. 2017
Reporter-activating sgRNA
Transcribed from PthsR.
sgRNAdesigned for CRISPRa upstream of a weak reporter promoter
sgRNA scaffold (SpCas9)
GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC
sgRNAStandard SpCas9 scaffold
dCas9-ω activatordCas9CRISPRa (Bikard et al. 2013; Dong et al. 2018)
sfGFP / mCherry reporter
Fluorescent readout recoverable from stool for non-invasive monitoring.
reporterstandard fluorophores

Output & readout

Type
fluorescent
Reporter
sfGFP
Readout
Fluorescence (flow cytometry / plate reader on recovered cells)
Positive result
Fluorescent-cell fraction rises with gut thiosulfate (inflammation).

Performance

Limit of detection
ThsSR module validated to report thiosulfate in mouse gut (Daeffler et al. 2017).
Dynamic range
Physiological gut thiosulfate range
Response time
~240 min
Device validated
No — design template (parts validated individually)

The thiosulfate sensor in E. coli Nissle is validated in vivo; the CRISPRa amplifier integration is a design template intended to boost the in-vivo signal.

Safety

Biosafety level
BSL-1 (non-pathogenic chassis)
GRAS chassis
No
Biocontainment
Built in the probiotic E. coli Nissle 1917; pair with thyA/dapA auxotrophy for gut-restricted containment before any in-vivo use.
Field-deployable
Lab / supervised use

Probiotic chassis with a long human-safety record; intended for research / supervised clinical study only.

Build & run

#StageStep
1designDesign CRISPRa sgRNA
Target the activation window of a weak reporter promoter; verify Nissle off-targets.
2assemblyAssemble units
TU1: ThsS/ThsR. TU2: PthsR -> sgRNA. TU3: dCas9-omega. TU4: weak promoter -> sfGFP. Integrate or use a stable low-copy vector.
3transformationTransform E. coli Nissle 1917
Select; add an auxotrophic containment marker.
4inductionExpose to thiosulfate
Validate in vitro across a thiosulfate curve before any animal work.
5readoutRecover and measure
Recover cells (e.g. from stool) and quantify fluorescence.

Source & parts

Design
Design template combining the validated ThsSR thiosulfate sensor in E. coli Nissle with a dCas9 CRISPRa amplifier
Parts validated in
  • Daeffler et al. 2017, Mol. Syst. Biol. (thiosulfate sensor in E. coli Nissle)
  • Riglar et al. 2017, Nat. Biotechnol. (engineered Nissle gut sensors)
  • Bikard et al. 2013, NAR (CRISPRa)
License
Parts per their original sources; design template CC BY 4.0