Glucose sensor (CRP/cAMP + CRISPRi)
Reports glucose via catabolite repression (CRP/cAMP). When glucose is low, cAMP-CRP activates its promoters; when glucose is high, it switches off. CRP gates a CRISPRi circuit driving a fluorescent reporter, in the probiotic E. coli Nissle 1917 — relevant to gut/metabolic monitoring.
Clinical / gut biomarkerBSL-1 chassistemplateclinical-gutglucosemetaboliccatabolite-repressionprobioticNissleCRISPRi
Input
Glucose
Clinical / gut biomarker
→
Sense
CRISPRi-repression
dCas9 (S. pyogenes, catalytically dead)
→
Chassis
E. coli Nissle 1917
BSL-1
→
Output
sfGFP
fluorescent
What it detects
- Analyte
- Glucose — CRP/cAMP responds across the glucose-rich to -poor transition
- Category
- Clinical / gut biomarker
- Signal
- Glucose availability via the cAMP-CRP catabolite-repression system
Genetic circuit
⤢ click to enlarge
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
⤢ click to enlarge
CRISPR sensing mechanism
- Strategy
- CRISPRi-repression · NOT logic
- Cas protein
- dCas9 (S. pyogenes, catalytically dead)
- Analyte sensor
- Low glucose raises cAMP, which binds CRP to activate CRP-dependent promoters; high glucose lowers cAMP and switches them off.
Signal flow
Glucose change -> cAMP-CRP activity at Pcrp -> transcribes an sgRNA -> CRISPRi inverts a constitutive reporter (NOT). Net: reporter tracks glucose (via the CRP inversion); choose inverter polarity for the desired direction.Safe chassis
E. coli Nissle 1917 — Escherichia coli
A probiotic E. coli used in humans for over a century (Mutaflor). Colonizes the gut safely, making it the chassis of choice for clinical / gut biomarker biosensors.
BSL-1probiotic
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| CRP (cAMP receptor protein) Glucose/catabolite-state sensor; endogenous to E. coli Nissle. | regulator | Native E. coli crp / cya (cAMP) |
| CRP-dependent promoter Active at low glucose (high cAMP-CRP). | promoter | E. coli CRP-activated promoter (e.g. derived from lac/cat) |
| sgRNA | sgRNA | designed against the reporter promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| dCas9 | dCas9 | Qi et al. 2013 (CRISPRi) |
| sfGFP reporter Recoverable from stool for non-invasive readout. | reporter | Pedelacq et al. 2006 |
Output & readout
- Type
- fluorescent
- Reporter
- sfGFP
- Readout
- Fluorescence (flow cytometry on recovered cells)
- Positive result
- Signal tracks glucose availability (via the CRP/CRISPRi inversion).
Performance
- Limit of detection
- CRP/cAMP reports the glucose-rich to -poor transition (module-validated).
- Dynamic range
- Glucose-replete to -limited transition
- Response time
- ~150 min
- Device validated
- No — design template (parts validated individually)
An indirect, relative glucose readout via catabolite repression; CRP and CRISPRi are validated separately and integration is a design template.
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- No
- Biocontainment
- Probiotic E. coli Nissle host; add thyA/dapA auxotrophy for gut-restricted containment.
- Field-deployable
- Lab / supervised use
Probiotic chassis with a human-safety record; research / supervised clinical use only.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Design sgRNA + choose polarity Target the reporter promoter; pick inverter polarity for the desired glucose direction. |
| 2 | assembly | Assemble units TU1: CRP-dependent promoter -> sgRNA (native CRP/cAMP). TU2: dCas9 + reporter. Low-copy vector. |
| 3 | transformation | Transform E. coli Nissle 1917 Select; add auxotrophic containment. |
| 4 | induction | Validate in vitro Confirm response across a glucose series before any animal work. |
| 5 | readout | Recover and measure Recover cells from stool; quantify fluorescence. |
Source & parts
- Design
- Design template combining the native E. coli CRP/cAMP catabolite system with a dCas9 CRISPRi circuit in E. coli Nissle
- Parts validated in
- Busby & Ebright / CRP-cAMP catabolite repression (E. coli)
- Qi et al. 2013, Cell (CRISPRi)
- License
- Parts per their original sources; design template CC BY 4.0