Formaldehyde sensor (HxlR + CRISPRa)
Detects toxic formaldehyde in water, air, and materials. The native B. subtilis HxlR formaldehyde regulator gates a CRISPRa circuit driving a fluorescent reporter, in spore-forming Bacillus subtilis 168.
Chemical / metaboliteBSL-1 chassisGRAStemplateformaldehydeindoor-airpollutantchemicalCRISPRaspore
Input
Formaldehyde (HCHO)
Chemical / metabolite
→
Sense
CRISPRa-activation
dCas9-ω (CRISPRa activator)
→
Chassis
Bacillus subtilis 168
BSL-1
→
Output
sfGFP
fluorescent
What it detects
- Analyte
- Formaldehyde (HCHO) — HxlR responds across µM formaldehyde
- Category
- Chemical / metabolite
- Signal
- Formaldehyde in water, off-gassing materials, and indoor air
Genetic circuit
⤢ click to enlarge
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
⤢ click to enlarge
CRISPR sensing mechanism
- Strategy
- CRISPRa-activation · amplifier logic
- Cas protein
- dCas9-ω (CRISPRa activator)
- Analyte sensor
- HxlR activates the hxlAB formaldehyde-detoxification operon in response to formaldehyde.
Signal flow
HCHO -> HxlR activates PhxlA -> transcribes an sgRNA -> dCas9-activator amplifies a fluorescent reporter (CRISPRa) -> fluorescence rises with formaldehyde.Safe chassis
Bacillus subtilis 168 — Bacillus subtilis
Gram-positive, spore-forming model bacterium with QPS (EFSA) status and a long history of safe industrial use. Spores make it robust for field-deployable and environmental biosensors.
BSL-1GRAS · EFSA Qualified Presumption of Safety (QPS)
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| HxlR regulator Formaldehyde-responsive activator (RIPSU/MerR-like). | regulator | Native B. subtilis hxlR |
| PhxlA promoter Activated by HxlR under formaldehyde. | promoter | B. subtilis hxlAB promoter |
| Reporter-activating sgRNA | sgRNA | designed for CRISPRa upstream of a weak reporter promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| dCas9-ω activator | dCas9 | Bikard et al. 2013 (CRISPRa) |
| sfGFP | reporter | Pedelacq et al. 2006 |
Output & readout
- Type
- fluorescent
- Reporter
- sfGFP
- Readout
- Green fluorescence (field fluorimeter)
- Positive result
- Fluorescence increases with formaldehyde.
Performance
- Limit of detection
- HxlR module: µM formaldehyde (module-validated).
- Dynamic range
- ~1-100 µM formaldehyde
- Response time
- ~180 min
- Device validated
- No — design template (parts validated individually)
HxlR formaldehyde sensing and CRISPRa are validated separately; integrated device is a design template.
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- Yes
- Biocontainment
- GRAS, spore-forming host; auxotrophic/spore containment.
- Field-deployable
- Yes (with containment)
Spores allow ambient storage and field reconstitution.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Design CRISPRa sgRNA Target a weak reporter promoter; check B. subtilis off-targets. |
| 2 | assembly | Assemble units TU1: PhxlA -> sgRNA (native HxlR). TU2: dCas9-omega. TU3: weak promoter -> sfGFP. Integrate at amyE. |
| 3 | transformation | Transform B. subtilis 168 Natural competence; select; confirm formaldehyde-dependent activation. |
| 4 | induction | Expose to sample Reconstitute spores; add sample + formaldehyde standard curve. |
| 5 | readout | Measure fluorescence Interpolate formaldehyde from the curve. |
Source & parts
- Design
- Design template combining the native B. subtilis HxlR formaldehyde sensor with CRISPRa
- Parts validated in
- Yurimoto et al. / B. subtilis HxlR formaldehyde regulation
- Bikard et al. 2013, NAR (CRISPRa)
- License
- Parts per their original sources; design template CC BY 4.0