Explosives/landmine sensor (YqjF + CRISPRa)
Detects buried explosives by sensing DNT vapour (a TNT degradation product that leaks from landmines). The YqjF sensor gates a CRISPRa circuit driving a fluorescent reporter, in safe E. coli K-12.
Environmental contaminantBSL-1 chassistemplateexplosivesDNTTNTlandmineenvironmentalCRISPRasoil
Input
2,4-Dinitrotoluene (DNT) / TNT degradation products
Environmental contaminant
→
Sense
CRISPRa-activation
dCas9-ω (CRISPRa activator)
→
Chassis
E. coli K-12 (MG1655)
BSL-1
→
Output
sfGFP
fluorescent
What it detects
- Analyte
- 2,4-Dinitrotoluene (DNT) / TNT degradation products — Engineered YqjF reporters detect ppb-level DNT
- Category
- Environmental contaminant
- Signal
- DNT vapour leaking from buried explosives / landmines in soil
Genetic circuit
⤢ click to enlarge
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
⤢ click to enlarge
CRISPR sensing mechanism
- Strategy
- CRISPRa-activation · amplifier logic
- Cas protein
- dCas9-ω (CRISPRa activator)
- Analyte sensor
- The yqjF promoter (PyqjF) is induced by DNT degradation products; its regulator de-represses on exposure.
Signal flow
DNT -> PyqjF activates -> transcribes an sgRNA -> dCas9-activator amplifies a fluorescent reporter (CRISPRa) -> fluorescence over buried explosives.Safe chassis
E. coli K-12 (MG1655) — Escherichia coli
The non-pathogenic laboratory workhorse. K-12 strains have lost the ability to colonize the human gut and are the reference BSL-1 host for genetic engineering, with the deepest tooling of any bacterial chassis.
BSL-1
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| YqjF sensing module + PyqjF DNT-responsive promoter used in landmine-detection biosensors. | regulator | E. coli yqjF locus; engineered as a DNT biosensor (Belkin lab) |
| PyqjF promoter Induced by DNT degradation products. | promoter | E. coli yqjF promoter |
| Reporter-activating sgRNA | sgRNA | designed for CRISPRa upstream of a weak reporter promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| dCas9-ω activator | dCas9 | Bikard et al. 2013 (CRISPRa) |
| sfGFP Cells embedded in beads scattered over a minefield, scanned by laser/drone. | reporter | Pedelacq et al. 2006 |
Output & readout
- Type
- fluorescent
- Reporter
- sfGFP
- Readout
- Green fluorescence (remote laser scan / drone)
- Positive result
- Fluorescent patches mark buried explosives.
Performance
- Limit of detection
- Engineered YqjF reporters: ppb DNT (module-validated, Belkin lab field tests).
- Dynamic range
- ppb-ppm DNT
- Response time
- ~360 min
- Device validated
- No — design template (parts validated individually)
The YqjF DNT biosensor is field-validated for landmine detection; the CRISPRa amplifier integration is a design template to boost the signal.
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- No
- Biocontainment
- Encapsulate cells in hydrogel beads; pair with a kill-switch for outdoor use.
- Field-deployable
- Yes (with containment)
E. coli K-12 non-pathogenic BSL-1 host; a humanitarian demining application.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Design CRISPRa sgRNA Target a weak reporter promoter; check host off-targets. |
| 2 | assembly | Assemble units TU1: PyqjF -> sgRNA. TU2: dCas9-omega. TU3: weak promoter -> sfGFP. |
| 3 | transformation | Transform E. coli K-12 Select; confirm DNT-dependent activation. |
| 4 | induction | Deploy/expose Encapsulate; expose to soil headspace + DNT standard. |
| 5 | readout | Remote scan Scan for fluorescent patches. |
Source & parts
- Design
- Design template combining the YqjF DNT/landmine biosensor with E. coli CRISPRa
- Parts validated in
- Belkin et al. 2017, Nat. Biotechnol. (microbial landmine detection, yqjF)
- Bikard et al. 2013, NAR (CRISPRa)
- License
- Parts per their original sources; design template CC BY 4.0