Estrogen / endocrine-disruptor sensor (ERα + CRISPRa)
Detects estrogens and estrogenic endocrine-disrupting chemicals in water. Uses the human estrogen receptor (ERα) expressed in GRAS baker's yeast — a eukaryotic sensing class bacteria cannot do — gating a CRISPRa circuit driving a fluorescent reporter.
What it detects
- Analyte
- Estrogens / estrogenic EDCs — Yeast ERα assays detect sub-nM to nM 17β-estradiol
- Category
- Chemical / metabolite
- Signal
- 17β-estradiol and estrogen-mimicking endocrine disruptors in water
Genetic circuit
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
CRISPR sensing mechanism
- Strategy
- CRISPRa-activation · amplifier logic
- Cas protein
- dCas9-VPR (eukaryotic CRISPRa activator)
- Analyte sensor
- Ligand-bound human ERα binds estrogen-response elements (EREs), activating an ERE-controlled promoter (the classic yeast estrogen screen).
Safe chassis
GRAS baker's yeast — the model eukaryote. Being a eukaryote, it can host human nuclear receptors and GPCRs, unlocking sensing of steroids, hormones, and other eukaryotic-specific ligands that bacteria cannot detect. dCas9 CRISPRi/CRISPRa are well established.
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| Human estrogen receptor alpha (ERα) Ligand-activated nuclear receptor — requires a eukaryotic host. | regulator | Human ESR1, expressed in yeast (Routledge & Sumpter 1996, yeast estrogen screen) |
| ERE promoter Activated by ligand-bound ERα. | promoter | Estrogen-response-element-controlled yeast promoter |
| Reporter-activating sgRNA | sgRNA | designed for CRISPRa upstream of a weak yeast promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| dCas9-VPR Eukaryotic transcriptional activator. | dCas9 | Yeast CRISPRa (dCas9 fused to VPR/VP64) |
| yEGFP | reporter | yeast-enhanced GFP |
Output & readout
- Type
- fluorescent
- Reporter
- yEGFP
- Readout
- Green fluorescence (plate reader)
- Positive result
- Fluorescence increases with estrogenic activity.
Performance
- Limit of detection
- Yeast ERα assays: sub-nM 17β-estradiol (module-validated).
- Dynamic range
- ~0.1-10 nM estradiol equivalents
- Response time
- ~360 min
- Device validated
- No — design template (parts validated individually)
The yeast estrogen screen (ERα + ERE) is a validated assay; the CRISPRa-amplified version here is a design template. Reports total estrogenic activity (a key advantage for unknown EDC mixtures).
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- Yes
- Biocontainment
- Auxotrophic markers; GRAS yeast host.
- Field-deployable
- Yes (with containment)
GRAS baker's yeast; eukaryotic chassis enables human-receptor-based sensing.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Design CRISPRa sgRNA Target a weak yeast promoter; check S. cerevisiae off-targets. |
| 2 | assembly | Assemble units Express ERα; ERE -> sgRNA; dCas9-VPR; weak promoter -> yEGFP. Use the Yeast Toolkit (MoClo). |
| 3 | transformation | Transform S. cerevisiae Integrate at defined loci; select on auxotrophic markers. |
| 4 | induction | Expose to sample Incubate with the water sample + estradiol standard curve. |
| 5 | readout | Measure fluorescence Report estradiol-equivalent estrogenic activity. |
Source & parts
- Design
- Design template combining the yeast estrogen screen (ERα/ERE) with eukaryotic CRISPRa
- Parts validated in
- Routledge & Sumpter 1996 (yeast estrogen screen, ERα/ERE)
- Yeast dCas9-VPR CRISPRa literature
- License
- Parts per their original sources; design template CC BY 4.0