EHEC sensor (AI-3/QseC + CRISPRi)
Detects enterohemorrhagic E. coli (EHEC) signalling via the AI-3 / host-adrenergic pathway. The QseC/QseB sensor gates a CRISPRi circuit driving a fluorescent reporter, in the probiotic gut chassis E. coli Nissle 1917.
Pathogen signalBSL-1 chassistemplatepathogenEHECAI-3epinephrineclinical-gutprobioticNissleCRISPRi
Input
AI-3 / epinephrine / norepinephrine
Pathogen signal
→
Sense
CRISPRi-repression
dCas9 (S. pyogenes, catalytically dead)
→
Chassis
E. coli Nissle 1917
BSL-1
→
Output
sfGFP
fluorescent
What it detects
- Analyte
- AI-3 / epinephrine / norepinephrine — QseC responds across µM catecholamine / AI-3
- Category
- Pathogen signal
- Signal
- The AI-3 inter-kingdom signal and host catecholamines that activate EHEC virulence
Genetic circuit
⤢ click to enlarge
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
⤢ click to enlarge
CRISPR sensing mechanism
- Strategy
- CRISPRi-repression · NOT logic
- Cas protein
- dCas9 (S. pyogenes, catalytically dead)
- Analyte sensor
- The QseC sensor kinase detects AI-3/epinephrine and phosphorylates QseB, activating QseB-dependent promoters.
Signal flow
AI-3/epinephrine -> QseC/QseB activates its promoter -> transcribes an anti-reporter sgRNA -> CRISPRi inverts a constitutive reporter (NOT). Pair with a memory switch to record an EHEC-signalling episode in the gut.Safe chassis
E. coli Nissle 1917 — Escherichia coli
A probiotic E. coli used in humans for over a century (Mutaflor). Colonizes the gut safely, making it the chassis of choice for clinical / gut biomarker biosensors.
BSL-1probiotic
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| QseC/QseB two-component system AI-3/catecholamine-responsive; native E. coli framework (works in Nissle). | regulator | Enterohemorrhagic E. coli adrenergic sensor |
| QseB target promoter Activated by phospho-QseB. | promoter | EHEC qse regulon |
| Anti-reporter sgRNA | sgRNA | designed against the reporter promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| dCas9 | dCas9 | Qi et al. 2013 (CRISPRi) |
| sfGFP reporter Recoverable from stool for non-invasive readout. | reporter | Pedelacq et al. 2006 |
Output & readout
- Type
- fluorescent
- Reporter
- sfGFP
- Readout
- Fluorescence (flow cytometry on recovered cells)
- Positive result
- Signal reports AI-3 / EHEC-type adrenergic signalling in the gut.
Performance
- Limit of detection
- QseC module: µM catecholamine/AI-3 (module-validated).
- Dynamic range
- ~1-100 µM
- Response time
- ~240 min
- Device validated
- No — design template (parts validated individually)
Detects a virulence-activating signal rather than the live pathogen; QseC/QseB and CRISPRi are validated separately and integration is a design template.
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- No
- Biocontainment
- Probiotic E. coli Nissle host; add thyA/dapA auxotrophy for gut-restricted containment.
- Field-deployable
- Lab / supervised use
Probiotic chassis with a human-safety record; research / supervised clinical use only.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Design sgRNA (+ optional memory) Target the reporter promoter; optionally add a memory switch. |
| 2 | assembly | Assemble units TU1: QseC/QseB. TU2: target promoter -> sgRNA. TU3: dCas9 + reporter. Low-copy vector. |
| 3 | transformation | Transform E. coli Nissle 1917 Select; add auxotrophic containment. |
| 4 | induction | Validate in vitro Confirm AI-3/epinephrine response before any animal work. |
| 5 | readout | Recover and measure Recover cells from stool; quantify fluorescence. |
Source & parts
- Design
- Design template combining the QseC/QseB AI-3 adrenergic sensor with a dCas9 CRISPRi circuit in E. coli Nissle
- Parts validated in
- Sperandio et al. / QseC AI-3 inter-kingdom signalling (EHEC)
- Qi et al. 2013, Cell (CRISPRi)
- License
- Parts per their original sources; design template CC BY 4.0