Cuminate sensor (CymR + CRISPRa)
Detects cuminate (p-isopropylbenzoate), a terpenoid-degradation marker. The native P. putida CymR sensor gates a CRISPRa circuit driving a fluorescent reporter, in P. putida KT2440.
Chemical / metaboliteBSL-1 chassistemplatecuminatecumateterpenoidchemicalMarionetteCRISPRa
Input
Cuminate (p-isopropylbenzoate) / cumate
Chemical / metabolite
→
Sense
CRISPRa-activation
dCas9-ω (CRISPRa activator)
→
Chassis
Pseudomonas putida KT2440
BSL-1
→
Output
sfGFP
fluorescent
What it detects
- Analyte
- Cuminate (p-isopropylbenzoate) / cumate — CymR responds across µM cumate
- Category
- Chemical / metabolite
- Signal
- Cuminate/cumate in degradation streams and as a process marker
Genetic circuit
⤢ click to enlarge
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
⤢ click to enlarge
CRISPR sensing mechanism
- Strategy
- CRISPRa-activation · amplifier logic
- Cas protein
- dCas9-ω (CRISPRa activator)
- Analyte sensor
- CymR de-represses the Pcym/Pcmt promoter on binding cumate.
Signal flow
Cumate -> CymR releases Pcym -> transcribes an sgRNA -> dCas9-activator amplifies a fluorescent reporter (CRISPRa) -> fluorescence rises with cuminate.Safe chassis
Pseudomonas putida KT2440 — Pseudomonas putida
A certified safety-strain soil bacterium with exceptional solvent/stress tolerance and diverse metabolism. The premier chassis for environmental biosensing of pollutants and heavy metals in soil and water.
BSL-1
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| CymR regulator Cumate-responsive repressor; endogenous to P. putida. | regulator | Native P. putida cym/cmt operon (also a Marionette sensor) |
| Pcym promoter De-repressed by cumate-bound CymR. | promoter | P. putida cym operon promoter |
| Reporter-activating sgRNA | sgRNA | designed for CRISPRa upstream of a weak reporter promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| dCas9-ω activator | dCas9 | Bikard et al. 2013 (CRISPRa) |
| sfGFP | reporter | Pedelacq et al. 2006 |
Output & readout
- Type
- fluorescent
- Reporter
- sfGFP
- Readout
- Green fluorescence (plate reader)
- Positive result
- Fluorescence increases with cuminate.
Performance
- Limit of detection
- CymR module: µM cumate (module-validated).
- Dynamic range
- ~1-100 µM cumate
- Response time
- ~150 min
- Device validated
- No — design template (parts validated individually)
CymR is native to P. putida and a characterised Marionette sensor; integrated CRISPRa device is a design template.
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- No
- Biocontainment
- P. putida KT2440 certified HV1 safety host; add containment for field use.
- Field-deployable
- Yes (with containment)
Native sensor in the host — minimal porting needed.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Design CRISPRa sgRNA Target a weak reporter promoter; check host off-targets. |
| 2 | assembly | Assemble units TU1: Pcym -> sgRNA (native CymR). TU2: dCas9-omega. TU3: weak promoter -> sfGFP. SEVA vectors. |
| 3 | transformation | Transform P. putida KT2440 Electroporate; select; confirm cumate-dependent activation. |
| 4 | induction | Expose to sample Add sample + cumate standard curve. |
| 5 | readout | Measure fluorescence Interpolate cuminate from the curve. |
Source & parts
- Design
- Design template combining the native P. putida CymR cumate sensor with CRISPRa
- Parts validated in
- Eaton / P. putida cym-cmt cumate regulation; Meyer et al. 2019 (Marionette CymR)
- Bikard et al. 2013, NAR (CRISPRa)
- License
- Parts per their original sources; design template CC BY 4.0