Copper soil sensor (CueR + CRISPRi)
Detects bioavailable copper Cu(I)/Cu(II) in soil and water. The CueR copper-responsive regulator gates a CRISPRi circuit driving a visible chromoprotein, in the robust environmental chassis P. putida KT2440.
Environmental contaminantBSL-1 chassistemplatecopperheavy-metalsoilwaterenvironmentalCRISPRichromoprotein
Input
Copper Cu(I)/Cu(II)
Environmental contaminant
→
Sense
CRISPRi-repression
dCas9 (S. pyogenes, catalytically dead)
→
Chassis
Pseudomonas putida KT2440
BSL-1
→
Output
amilCP
pigment
What it detects
- Analyte
- Copper Cu(I)/Cu(II) — CueR-family sensors respond from sub-µM copper
- Category
- Environmental contaminant
- Signal
- Bioavailable copper in soil/water (agricultural and mining contamination)
Genetic circuit
⤢ click to enlarge
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
⤢ click to enlarge
CRISPR sensing mechanism
- Strategy
- CRISPRi-repression · NOT logic
- Cas protein
- dCas9 (S. pyogenes, catalytically dead)
- Analyte sensor
- CueR (a MerR-family regulator) binds Cu(I) and activates the copper-responsive PcopA/PcueO promoter.
Signal flow
Cu -> CueR activates PcopA -> transcribes an anti-pigment sgRNA -> dCas9 + sgRNA repress a constitutive amilCP cassette (CRISPRi) -> pigment fades as copper rises (NOT gate). Pair an inverter for colour-on output.Safe chassis
Pseudomonas putida KT2440 — Pseudomonas putida
A certified safety-strain soil bacterium with exceptional solvent/stress tolerance and diverse metabolism. The premier chassis for environmental biosensing of pollutants and heavy metals in soil and water.
BSL-1
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| CueR regulator Copper-responsive activator. | regulator | E. coli cue system (MerR family); P. putida CopR/CueR homologs |
| PcopA / PcueO promoter Activated by Cu-bound CueR. | promoter | copper-responsive operator/promoter |
| Anti-reporter sgRNA | sgRNA | designed against the amilCP promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| dCas9 | dCas9 | CRISPRi (established in P. putida) |
| amilCP chromoprotein Visible blue-purple pigment (no instrument). | reporter | BBa_K592009 |
Output & readout
- Type
- pigment
- Reporter
- amilCP
- Readout
- Visible pigment (naked eye / smartphone)
- Positive result
- Pigment intensity reports copper concentration.
Performance
- Limit of detection
- CueR module: sub-µM copper (module-validated).
- Dynamic range
- ~0.1-10 µM copper
- Response time
- ~180 min
- Device validated
- No — design template (parts validated individually)
CueR copper sensors and P. putida CRISPRi are validated separately; integrated device is a design template.
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- No
- Biocontainment
- P. putida KT2440 is a certified HV1 safety host; add a containment circuit for field use.
- Field-deployable
- Yes (with containment)
Robust soil chassis; instrument-free pigment readout.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Design anti-reporter sgRNA Target the amilCP promoter; check host off-targets. |
| 2 | assembly | Assemble units TU1: CueR. TU2: PcopA -> sgRNA. TU3: dCas9 + constitutive amilCP. Clone into SEVA vectors. |
| 3 | transformation | Transform P. putida KT2440 Electroporate; select; confirm baseline pigment without copper. |
| 4 | induction | Expose to sample Add soil eluate/water + copper standard curve. |
| 5 | readout | Score colour Compare pigment to the curve by eye or camera. |
Source & parts
- Design
- Design template combining a CueR copper-sensing module with P. putida CRISPRi
- Parts validated in
- Stoyanov et al. 2001 / CueR copper sensing (E. coli cue system)
- iGEM Uppsala amilCP (BBa_K592009)
- License
- Parts per their original sources; design template CC BY 4.0