Chromate sensor (ChrR + CRISPRi)
Detects toxic hexavalent chromium (chromate) in industrial water. The ChrR chromate-responsive regulator gates a CRISPRi circuit driving a fluorescent reporter, in the robust GRAS industrial chassis Corynebacterium glutamicum.
Environmental contaminantBSL-1 chassisGRAStemplatechromatechromiumheavy-metalindustrialwaterenvironmentalCRISPRi
Input
Chromate Cr(VI)
Environmental contaminant
→
Sense
CRISPRi-repression
dCas9 (S. pyogenes, catalytically dead)
→
Chassis
Corynebacterium glutamicum (ATCC 13032)
BSL-1
→
Output
sfGFP
fluorescent
What it detects
- Analyte
- Chromate Cr(VI) — ChrR/chr operon responds across µM chromate
- Category
- Environmental contaminant
- Signal
- Hexavalent chromium in industrial effluent and water
Genetic circuit
⤢ click to enlarge
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
⤢ click to enlarge
CRISPR sensing mechanism
- Strategy
- CRISPRi-repression · NOT logic
- Cas protein
- dCas9 (S. pyogenes, catalytically dead)
- Analyte sensor
- ChrR/ChrB regulators of chromate-resistance operons respond to chromate and switch the chr promoter.
Signal flow
Cr(VI) -> ChrR switches Pchr -> transcribes an anti-reporter sgRNA -> CRISPRi inverts a constitutive reporter (NOT). Pair an inverter for turn-on.Safe chassis
Corynebacterium glutamicum (ATCC 13032) — Corynebacterium glutamicum
A GRAS industrial workhorse used for food-grade amino-acid production at megaton scale. Robust, stress-tolerant, and easy to grow at high density — well suited to industrial-process and chemical monitoring.
BSL-1GRAS · EFSA QPS
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| ChrR regulator Chromate-responsive; port into C. glutamicum. | regulator | Chromate-resistance (chr) operon regulator |
| Pchr promoter Switched by chromate-bound ChrR. | promoter | chr operon promoter |
| Anti-reporter sgRNA | sgRNA | designed against the reporter promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| dCas9 | dCas9 | Cleto et al. 2016 (CRISPRi in C. glutamicum) |
| Ptuf promoter Drives the reporter (CRISPRi target). | promoter | C. glutamicum strong constitutive promoter |
| sfGFP | reporter | Pedelacq et al. 2006 |
Output & readout
- Type
- fluorescent
- Reporter
- sfGFP
- Readout
- Green fluorescence (plate reader)
- Positive result
- Fluorescence change reports chromate.
Performance
- Limit of detection
- ChrR module: µM chromate (module-validated).
- Dynamic range
- ~1-100 µM Cr(VI)
- Response time
- ~180 min
- Device validated
- No — design template (parts validated individually)
ChrR chromate sensing and C. glutamicum CRISPRi are validated separately; integrated device is a design template. C. glutamicum tolerates harsh industrial samples.
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- Yes
- Biocontainment
- Auxotrophic containment; GRAS industrial host.
- Field-deployable
- Yes (with containment)
GRAS, robust at high cell density for industrial monitoring.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Design anti-reporter sgRNA Target the reporter promoter; check C. glutamicum off-targets. |
| 2 | assembly | Assemble units TU1: ChrR + Pchr -> sgRNA. TU2: dCas9 + Ptuf -> sfGFP. |
| 3 | transformation | Transform C. glutamicum Electroporate; select; confirm low background. |
| 4 | induction | Expose to sample Add effluent sample + chromate standard curve. |
| 5 | readout | Measure fluorescence Interpolate chromate from the curve. |
Source & parts
- Design
- Design template combining a ChrR chromate-sensing module with C. glutamicum CRISPRi
- Parts validated in
- Chromate-resistance (chr) operon / ChrR literature
- Cleto et al. 2016, ACS Synth Biol (CRISPRi in C. glutamicum)
- License
- Parts per their original sources; design template CC BY 4.0