Choline sensor (BetI + CRISPRi)
Detects choline, a dietary precursor of the cardiovascular-risk metabolite TMA/TMAO in the gut. The Marionette BetI sensor gates a CRISPRi circuit driving a fluorescent reporter, in the probiotic E. coli Nissle 1917.
Clinical / gut biomarkerBSL-1 chassistemplatecholineTMAOmetaboliteclinical-gutprobioticNissleMarionetteCRISPRi
Input
Choline
Clinical / gut biomarker
→
Sense
CRISPRi-repression
dCas9 (S. pyogenes, catalytically dead)
→
Chassis
E. coli Nissle 1917
BSL-1
→
Output
sfGFP
fluorescent
What it detects
- Analyte
- Choline — BetI responds across µM-mM choline
- Category
- Clinical / gut biomarker
- Signal
- Luminal choline, the dietary precursor of gut-microbial TMA (and host TMAO)
Genetic circuit
⤢ click to enlarge
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
⤢ click to enlarge
CRISPR sensing mechanism
- Strategy
- CRISPRi-repression · NOT logic
- Cas protein
- dCas9 (S. pyogenes, catalytically dead)
- Analyte sensor
- BetI de-represses the Pbet promoter on binding choline.
Signal flow
Choline -> BetI releases Pbet -> transcribes an anti-reporter sgRNA -> CRISPRi inverts a constitutive reporter (NOT). Pair an inverter for turn-on monitoring of dietary choline load.Safe chassis
E. coli Nissle 1917 — Escherichia coli
A probiotic E. coli used in humans for over a century (Mutaflor). Colonizes the gut safely, making it the chassis of choice for clinical / gut biomarker biosensors.
BSL-1probiotic
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| BetI regulator Choline-responsive repressor. | regulator | Marionette sensor (Meyer et al. 2019); E. coli bet system |
| Pbet promoter De-repressed by choline-bound BetI. | promoter | E. coli betIBA promoter |
| Anti-reporter sgRNA | sgRNA | designed against the reporter promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| dCas9 | dCas9 | Qi et al. 2013 (CRISPRi) |
| sfGFP reporter Recoverable from stool for non-invasive readout. | reporter | Pedelacq et al. 2006 |
Output & readout
- Type
- fluorescent
- Reporter
- sfGFP
- Readout
- Fluorescence (flow cytometry on recovered cells)
- Positive result
- Signal reflects luminal choline load.
Performance
- Limit of detection
- BetI Marionette sensor: µM-mM choline (module-validated).
- Dynamic range
- ~10 µM - 1 mM choline
- Response time
- ~240 min
- Device validated
- No — design template (parts validated individually)
BetI is a characterised orthogonal Marionette sensor; integrated CRISPRi device is a design template. Relevant to TMAO/cardiovascular research.
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- No
- Biocontainment
- Probiotic E. coli Nissle host; add thyA/dapA auxotrophy for gut-restricted containment.
- Field-deployable
- Lab / supervised use
Probiotic chassis with a human-safety record; research / supervised clinical use only.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Design anti-reporter sgRNA Target the reporter promoter; check Nissle off-targets. |
| 2 | assembly | Assemble units TU1: BetI + Pbet -> sgRNA. TU2: dCas9 + constitutive sfGFP. Low-copy vector. |
| 3 | transformation | Transform E. coli Nissle 1917 Select; add auxotrophic containment. |
| 4 | induction | Validate in vitro Confirm choline response across a standard curve before any animal work. |
| 5 | readout | Recover and measure Recover cells from stool; quantify fluorescence. |
Source & parts
- Design
- Design template combining the Marionette BetI choline sensor with a dCas9 CRISPRi circuit in E. coli Nissle
- Parts validated in
- Meyer et al. 2019, Nat. Chem. Biol. (Marionette sensors, BetI)
- Qi et al. 2013, Cell (CRISPRi)
- License
- Parts per their original sources; design template CC BY 4.0