Cholera sensor (CAI-1 + CRISPRa)

Detects Vibrio cholerae by sensing its species-specific quorum signal CAI-1. The CqsS receptor gates a CRISPRa circuit driving a fluorescent reporter, in safe E. coli K-12 — no live pathogen required.

Pathogen signalBSL-1 chassistemplatecholeraVibrio choleraeCAI-1quorum-sensingpathogenwaterCRISPRa

Open in designer Design guide RNA

Input

CAI-1 (cholera autoinducer-1, (S)-3-hydroxytridecan-4-one)

Pathogen signal

→

Sense

CRISPRa-activation

dCas9-ω (CRISPRa activator)

→

Chassis

E. coli K-12 (MG1655)

BSL-1

→

Output

sfGFP

fluorescent

What it detects

Analyte: CAI-1 (cholera autoinducer-1, (S)-3-hydroxytridecan-4-one) — CqsS-based sensors respond from nM CAI-1
Category: Pathogen signal
Signal: The Vibrio cholerae-specific quorum autoinducer CAI-1 in water samples

Genetic circuit

⤢ click to enlarge

Genetic construct (SBOL)

The DNA construct as transcription units, drawn with SBOL Visual part glyphs.

⤢ click to enlarge

CRISPR sensing mechanism

Strategy: CRISPRa-activation · amplifier logic
Cas protein: dCas9-ω (CRISPRa activator)
Analyte sensor: The CqsS histidine kinase detects CAI-1 and, through the LuxO/HapR-type relay, switches its target promoter on.

Signal flow

CAI-1 -> CqsS signalling relay activates target promoter -> transcribes an sgRNA -> dCas9-activator amplifies a fluorescent reporter (CRISPRa) -> fluorescence rises when V. cholerae signal is present.

Safe chassis

E. coli K-12 (MG1655) — Escherichia coli

The non-pathogenic laboratory workhorse. K-12 strains have lost the ability to colonize the human gut and are the reference BSL-1 host for genetic engineering, with the deepest tooling of any bacterial chassis.

BSL-1

Genetic parts

Part	Role	Source / id
CqsS receptor + relay CAI-1-responsive sensor kinase; requires porting the relay into E. coli.	regulator	Vibrio cholerae cqsS/luxO/hapR quorum circuit
Quorum-responsive promoter Switched by the CAI-1 relay.	promoter	HapR/Qrr-controlled promoter
Reporter-activating sgRNA	sgRNA	designed for CRISPRa upstream of a weak reporter promoter
sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC	sgRNA	Standard SpCas9 scaffold
dCas9-ω activator	dCas9	Bikard et al. 2013 (CRISPRa)
sfGFP	reporter	Pedelacq et al. 2006

Output & readout

Type: fluorescent
Reporter: sfGFP
Readout: Green fluorescence (field fluorimeter)
Positive result: Fluorescence indicates V. cholerae quorum signal in water.

Performance

Limit of detection: CqsS CAI-1 sensing: nM range (module-validated in Vibrio).
Dynamic range: ~1-1000 nM CAI-1
Response time: ~240 min
Device validated: No — design template (parts validated individually)

Senses the pathogen's signal molecule, not the live organism; the CqsS relay and CRISPRa are validated separately and integration is a design template requiring relay porting into E. coli.

Safety

Biosafety level: BSL-1 (non-pathogenic chassis)
GRAS chassis: No
Biocontainment: Safe E. coli K-12 reads a secreted small molecule; no BSL-2 Vibrio culture needed.
Field-deployable: Yes (with containment)

Cholera surveillance without handling the live pathogen — a key safety advantage of signal-molecule sensing.

Build & run

#	Stage	Step
1	design	Port relay + design sgRNA Reconstitute the CqsS->LuxO->HapR relay in E. coli; design the CRISPRa sgRNA.
2	assembly	Assemble units TU1: CqsS relay. TU2: quorum promoter -> sgRNA. TU3: dCas9-omega. TU4: weak promoter -> sfGFP.
3	transformation	Transform E. coli K-12 Select; validate CAI-1-dependent activation.
4	induction	Add sample Incubate with the water sample + CAI-1 standard curve.
5	readout	Measure fluorescence Interpolate from the curve.

Source & parts

Design

Design template combining the Vibrio cholerae CqsS/CAI-1 quorum module with E. coli CRISPRa

Parts validated in

Higgins et al. 2007, Nature (CAI-1 / CqsS quorum sensing)
Bikard et al. 2013, NAR (CRISPRa)

License

Parts per their original sources; design template CC BY 4.0