Cadmium sensor (CadC + CRISPRi)
Detects toxic cadmium Cd(II) in water and soil. The CadC metal-responsive repressor gates a CRISPRi circuit driving sfGFP, in spore-forming Bacillus subtilis 168 for field-storable testing.
Environmental contaminantBSL-1 chassisGRAStemplatecadmiumheavy-metalwatersoilenvironmentalCRISPRisporefield
Input
Cadmium Cd(II)
Environmental contaminant
→
Sense
CRISPRi-repression
dCas9 (S. pyogenes, catalytically dead)
→
Chassis
Bacillus subtilis 168
BSL-1
→
Output
sfGFP
fluorescent
What it detects
- Analyte
- Cadmium Cd(II) — CadC sensors respond from sub-µM to µM Cd(II)
- Category
- Environmental contaminant
- Signal
- Bioavailable cadmium in water and soil
Genetic circuit
⤢ click to enlarge
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
⤢ click to enlarge
CRISPR sensing mechanism
- Strategy
- CRISPRi-repression · NOT logic
- Cas protein
- dCas9 (S. pyogenes, catalytically dead)
- Analyte sensor
- CadC, an ArsR/SmtB-family metalloregulator, releases its operator when it binds Cd(II), de-repressing the cad promoter.
Signal flow
Cd(II) -> CadC releases Pcad -> transcribes an anti-reporter sgRNA -> dCas9 + sgRNA repress a constitutive sfGFP cassette (CRISPRi) -> fluorescence inverts with cadmium (NOT). Pair an inverter for turn-on.Safe chassis
Bacillus subtilis 168 — Bacillus subtilis
Gram-positive, spore-forming model bacterium with QPS (EFSA) status and a long history of safe industrial use. Spores make it robust for field-deployable and environmental biosensors.
BSL-1GRAS · EFSA Qualified Presumption of Safety (QPS)
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| CadC regulator Cd(II)/Pb(II)-responsive repressor; native to Gram-positive metal-resistance systems. | regulator | Staphylococcus/Bacillus cad operon (ArsR/SmtB family) |
| Pcad promoter De-repressed by metal-bound CadC. | promoter | cad operon operator/promoter |
| Anti-reporter sgRNA | sgRNA | designed against the sfGFP promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| dCas9 | dCas9 | Peters et al. 2016 (CRISPRi in B. subtilis) |
| Pveg promoter Drives sfGFP (CRISPRi target). | promoter | B. subtilis vegetative promoter |
| sfGFP | reporter | Pedelacq et al. 2006 |
Output & readout
- Type
- fluorescent
- Reporter
- sfGFP
- Readout
- Green fluorescence (field fluorimeter)
- Positive result
- Fluorescence change scales with cadmium concentration.
Performance
- Limit of detection
- CadC module: sub-µM Cd(II) (module-validated).
- Dynamic range
- ~0.1-10 µM Cd(II)
- Response time
- ~150 min
- Device validated
- No — design template (parts validated individually)
CadC cadmium sensors and B. subtilis CRISPRi are validated separately; integrated device is a design template. CadC also responds to Pb(II), so confirm specificity against lead.
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- Yes
- Biocontainment
- GRAS, spore-forming host; auxotrophic/spore containment.
- Field-deployable
- Yes (with containment)
Spores allow ambient storage and field reconstitution.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Design anti-reporter sgRNA Target the sfGFP promoter; check B. subtilis off-targets. |
| 2 | assembly | Assemble units TU1: CadC. TU2: Pcad -> sgRNA. TU3: dCas9 + Pveg -> sfGFP. Integrate at amyE/thrC. |
| 3 | transformation | Transform B. subtilis 168 Use natural competence; select integrants; confirm low background. |
| 4 | induction | Expose to sample Reconstitute spores; add sample + cadmium standard curve. |
| 5 | readout | Measure fluorescence Interpolate Cd(II) from the curve. |
Source & parts
- Design
- Design template combining a CadC cadmium-sensing module with B. subtilis CRISPRi
- Parts validated in
- Endo & Silver 1995 / CadC metalloregulation literature
- Peters et al. 2016, Cell (CRISPRi in B. subtilis)
- License
- Parts per their original sources; design template CC BY 4.0