Benzoate sensor (BenM + CRISPRi)
Detects benzoate, a common aromatic pollutant and degradation intermediate. The BenM LysR-family regulator gates a CRISPRi circuit driving a visible pigment, in P. putida KT2440.
Environmental contaminantBSL-1 chassistemplatebenzoatearomaticpollutantsoilwaterenvironmentalCRISPRi
Input
Benzoate
Environmental contaminant
→
Sense
CRISPRi-repression
dCas9 (S. pyogenes, catalytically dead)
→
Chassis
Pseudomonas putida KT2440
BSL-1
→
Output
amilCP
pigment
What it detects
- Analyte
- Benzoate — BenM responds across µM benzoate / cis,cis-muconate
- Category
- Environmental contaminant
- Signal
- Benzoate in soil/water (aromatic-compound degradation marker)
Genetic circuit
⤢ click to enlarge
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
⤢ click to enlarge
CRISPR sensing mechanism
- Strategy
- CRISPRi-repression · NOT logic
- Cas protein
- dCas9 (S. pyogenes, catalytically dead)
- Analyte sensor
- BenM (LysR family) activates the benABC promoter in response to benzoate and its metabolite cis,cis-muconate.
Signal flow
Benzoate -> BenM activates PbenA -> transcribes an anti-pigment sgRNA -> CRISPRi represses a constitutive amilCP cassette -> pigment fades with benzoate (NOT). Pair an inverter for colour-on.Safe chassis
Pseudomonas putida KT2440 — Pseudomonas putida
A certified safety-strain soil bacterium with exceptional solvent/stress tolerance and diverse metabolism. The premier chassis for environmental biosensing of pollutants and heavy metals in soil and water.
BSL-1
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| BenM regulator Benzoate/cis,cis-muconate-responsive activator. | regulator | Acinetobacter baylyi ben operon (LysR family) |
| PbenA promoter Activated by effector-bound BenM. | promoter | ben operon promoter |
| Anti-pigment sgRNA | sgRNA | designed against the amilCP promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| dCas9 | dCas9 | CRISPRi (established in P. putida) |
| amilCP chromoprotein | reporter | BBa_K592009 |
Output & readout
- Type
- pigment
- Reporter
- amilCP
- Readout
- Visible pigment (naked eye / smartphone)
- Positive result
- Pigment change reports benzoate.
Performance
- Limit of detection
- BenM module: µM benzoate (module-validated).
- Dynamic range
- ~1-100 µM benzoate
- Response time
- ~180 min
- Device validated
- No — design template (parts validated individually)
BenM is a well-studied aromatic sensor; integrated CRISPRi device is a design template.
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- No
- Biocontainment
- P. putida KT2440 certified HV1 safety host; add containment for field use.
- Field-deployable
- Yes (with containment)
Aromatic-tolerant chassis; instrument-free readout.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Design anti-pigment sgRNA Target the amilCP promoter; check host off-targets. |
| 2 | assembly | Assemble units TU1: BenM + PbenA -> sgRNA. TU2: dCas9 + constitutive amilCP. SEVA vectors. |
| 3 | transformation | Transform P. putida KT2440 Electroporate; select; confirm baseline pigment without benzoate. |
| 4 | induction | Expose to sample Add soil eluate/water + benzoate standard curve. |
| 5 | readout | Score colour Compare pigment to the curve. |
Source & parts
- Design
- Design template combining the BenM benzoate-sensing module with P. putida CRISPRi
- Parts validated in
- Collier/Neidle / BenM benzoate regulation (Acinetobacter baylyi)
- Qi et al. 2013, Cell (CRISPRi)
- License
- Parts per their original sources; design template CC BY 4.0