Arsenic ratiometric quantifier

Quantifies arsenic with two reporters: an arsenic-driven green channel over a constitutive red channel. The green/red ratio cancels out cell number, growth, and instrument variation — giving a robust, self-normalizing readout for field quantitation.

Environmental contaminantratiometric circuitBSL-1 chassistemplatearsenicheavy-metalratiometricquantitativewaterenvironmentalCRISPRa

Open in designer Design guide RNA

Input

Arsenite As(III)

Environmental contaminant

→

Sense

CRISPRa-activation

dCas9-ω (CRISPRa activator)

→

Chassis

E. coli K-12 (MG1655)

BSL-1

→

Output

sfGFP / mCherry (ratio)

fluorescent

What it detects

ratiometric design — uses two reporters for self-normalizing quantitation.

Analyte: Arsenite As(III) — ArsR module around the 10 µg/L WHO limit and above
Category: Environmental contaminant
Signal: Arsenic, quantified by the green/red reporter ratio

Genetic circuit

⤢ click to enlarge

Genetic construct (SBOL)

The DNA construct as transcription units, drawn with SBOL Visual part glyphs.

⤢ click to enlarge

CRISPR sensing mechanism

Strategy: CRISPRa-activation · amplifier logic
Cas protein: dCas9-ω (CRISPRa activator)
Analyte sensor: Arsenite de-represses Pars; a constitutive promoter drives the normalizer reporter in parallel.

Signal flow

Arsenite -> ArsR releases Pars -> sgRNA -> dCas9-activator amplifies the GREEN reporter (CRISPRa). A constitutive promoter drives the RED normalizer independently. The GREEN/RED ratio is the arsenic readout, self-normalized against cell density and conditions.

Safe chassis

E. coli K-12 (MG1655) — Escherichia coli

The non-pathogenic laboratory workhorse. K-12 strains have lost the ability to colonize the human gut and are the reference BSL-1 host for genetic engineering, with the deepest tooling of any bacterial chassis.

BSL-1

Genetic parts

Part	Role	Source / id
ArsR + Pars Arsenite-responsive; drives the signal channel.	regulator	E. coli ars operon; Stocker et al. 2003
Reporter-activating sgRNA	sgRNA	transcribed from Pars
sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC	sgRNA	Standard SpCas9 scaffold
dCas9-ω activator	dCas9	Bikard et al. 2013 (CRISPRa)
sfGFP (signal channel) Arsenic-driven GREEN channel.	reporter	Pedelacq et al. 2006
J23119 -> mCherry (normalizer channel) Constitutive RED channel for normalization.	reporter	BBa_J23119

Output & readout

Type: fluorescent
Reporter: sfGFP / mCherry (ratio)
Readout: Green/red fluorescence ratio (plate reader / two-channel field reader)
Positive result: The GREEN/RED ratio scales with arsenic, independent of cell number.

Performance

Limit of detection: ArsR module near 10 µg/L; ratiometric output improves quantitation robustness.
Device validated: No — design template (parts validated individually)

Ratiometric two-reporter normalization is a validated quantitation strategy; this arsenic CRISPRa version is a design template. The ratio cancels cell-density and instrument variation.

Safety

Biosafety level: BSL-1 (non-pathogenic chassis)
GRAS chassis: No
Biocontainment: Lab/contained; add kill-switch for field use.
Field-deployable: Yes (with containment)

E. coli K-12 non-pathogenic BSL-1 host.

Build & run

#	Stage	Step
1	design	Design the two channels Signal: Pars -> CRISPRa -> sfGFP. Normalizer: J23119 -> mCherry. Design the sgRNA.
2	assembly	Assemble units TU1: ArsR + Pars -> sgRNA. TU2: dCas9-omega. TU3: weak promoter -> sfGFP. TU4: J23119 -> mCherry.
3	transformation	Transform E. coli K-12 Select; confirm stable red and arsenic-dependent green.
4	induction	Arsenic titration Run a standard curve; record green/red ratios.
5	readout	Compute ratio Interpolate arsenic from the GREEN/RED ratio.

Source & parts

Design

Design template: a ratiometric (two-reporter) arsenic quantifier with a CRISPRa signal channel

Parts validated in

Stocker et al. 2003 (ArsR)
Bikard et al. 2013, NAR (CRISPRa)
ratiometric reporter normalization (general)

License

Parts per their original sources; design template CC BY 4.0